EFFICIENCY OF FOUR DISINFECTANTS AGAINST EIMERIA TENELLA ISOLATES FROM EGYPTIAN CHICKENS (IN VITRO ASSESSMENT) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Assiut Veterinary Medical Journal | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Article 7, Volume 67, Issue 169, April 2021, Pages 91-100 PDF (660.4 K) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
DOI: 10.21608/avmj.2021.188826 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Authors | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
SHIEM EL-SHERRY1; MOHAMED A. ALY1; MOHAMED A. SOLIMAN2; MADEHA DARWISH3; OMAR AMEN1 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1Poultry Diseases Department, Faculty of Veterinary Medicine, Assiut University, Assiut 71526, Egypt | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
2Poultry and Fish Diseases Department, Faculty of Veterinary Medicine, Al Minia University, Al Minia 61519, Egypt. | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
3Department of Animal and Poultry Behavior and Management, Faculty of Veterinary Medicine, Assiut University, 71526, Egypt | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Abstract | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
ABSTRACT Background: Control of coccidiosis depends, in addition to the commercial preparation of herbal extracts, on good sanitation and litter management, along with the use of medication or vaccination programmes. In addition to the chemotherapeutic treatment of coccidiosis early disinfection of the poultry houses should be done using various disinfectants for controlling presence of oocysts.The objective of this research was to evaluate in vitro the action of four different coccidicidal disinfectant including (Quaternary ammonium compounds QACs, chlorocresol, glutaraldehyde and kilcox) on oocysts ofEimeriatenella. Methods: In this study the action of four coccidicidal disinfectant including (Quaternary ammonium compounds QACs, chlorocresol, glutaraldehyde and kilcox) on both sporulated and unsporulatedoocysts ofEimeriatenella was evaluated in vitro. E. tenellaOocysts were obtained from naturally infected Egyptian native breed chickens. The oocysts were exposed to the disinfectants at different concentrations and different contact times. The efficacy of the disinfection was assessed by either destruction of sporulatedoocyst or inhibition of sporulation.Results: It was observed that the most efficacious disinfectants against unsporulated and sporulatedE. tenellaoocystswaskilcox followed by chlorocresol, while QACs and, glutaraldehyde were less effective. kilcox sporulation inhibition reached 100 % on unsporulatedE. tenellaoocysts,and their destructive effect reached 99% on sporulatedoocysts. furthermore, the results showed that both inhibitory and destructive activity of the tested disinfectants was significantly increased by increasing their concentrations and/or the contact time. | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Keywords | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Key words:Eimeriatenella; chlorocresol; Chickens; sporulation | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Full Text | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Assiut University web-site: www.aun.edu.eg
EFFICIENCY OF FOUR DISINFECTANTS AGAINST EIMERIA TENELLA ISOLATES FROM EGYPTIAN CHICKENS (IN VITRO ASSESSMENT)
SHIEM EL-SHERRY 1; MOHAMED A. ALY 1; MOHAMED A. SOLIMAN 2; MADEHA DARWISH 3AND OMAR AMEN 1 1 Poultry Diseases Department, Faculty of Veterinary Medicine, Assiut University, Assiut 71526, Egypt 2Poultry and Fish Diseases Department, Faculty of Veterinary Medicine, Al Minia University, Al Minia 61519, Egypt. 3 Department of Animal and Poultry Behavior and Management, Faculty of Veterinary Medicine, Assiut University, 71526, Egypt.
Received:5April 2021; Accepted:30 April 2021
INTRODUCTION
Coccidiosis is one of the most serious apicomplexan parasites infecting domesticchickens as wellas other fowls. Recent
Corresponding author:Mohamed A. Soliman E-mail address:drmohamed.soliman@mu.edu.eg Present address:Poultry and Fish Diseases Department, Faculty of Veterinary Medicine, Al Minia University, Al Minia 61519, Egypt. reports estimated the direct losses from the disease to exceed one billion us dollars globally in the poultry sector (Allen and Fetterer, 2002). The unicellular protozoa invade the enterocytes of the birds, propagated in a sexual and sexual stages leading to destruction of epithelial lining intestine, bloody diarrhoea, dehydration, poor feed conversion, weight loss and death. Chickens can be infected by any of the seven Eimeria species, including Eimeriatenella (E. tenella), Eimeria maxima,Eimeriaacervulina, Eimerianecatrix, Eimeria brunette, Eimeriamitis, and Eimeria praecox. In Egypt, E. tenella was the most prevalent species among broiler flocks (Mahareek, 1992). In 2012, Abdel-Gawadet al., found that (25.82%) of 711 samples from Native chickens were infected with E. tenella.
E. tenellaoocystsporulated rapidly outside the infected host. Sporulation can be completed as early as 18 hours after oocysts shedding (Reid et al., 1991). The sporulation depends on many environmental factors, such as: temperature, humidity, and oxygen availability. Viability and infectivity of sporulatedoocysts can also depend on the parasite’s characteristics, like resistance of disinfectants and adverse field conditions (Fayer, 1980).
Disinfection plays the major role in control process of coccidiosis. Chemical disinfectants that are efficient in inactivating different micro-organisms such as bacteria, fungi or virus do not generally display sufficient coccidiocidal activity (Straberg and Daugschies, 2007). The wall of the oocystconsists of two chemically different layers and the combination of lipids and glycoproteins provides efficient protection of the germinal substance of the oocyst from the action of commonly used disinfectants (Greif et al., 2011). Each chemical disinfectant requires multi-optimized conditions to reach its maximum effectiveness such as contact time, concentration and the presence of organic materials that cover and protect oocysts from direct contact, the majority of the effective disinfectants on oocysts are caustic or toxic, inducing dangerous corrosive and health threating side effects upon their use in poultry installations. Studies were carried out worldwide to assess the action of various active principles with disinfectant action over Eimeria spp.oocysts (Fayer, 1980).
The disinfection efficacy (DE) is defined as the sporulation inhibition percentage of oocysts (Daugschieset al., 2002). After in vitro incubation, the coccidiocidal effect of the disinfectant is indicated by its capability of prevent sporulation (Williams, 1997).
This action is observed under two forms on the optic microscope: the oocysts present have lysed wall so, no sporulation occurs, or the wall keeps itself visually preserved, but the oocysts did not sporulate (Daugschieset al., 2002). Though disinfection is widely recognized as an important component of hygiene management (Straberg and Daugschies, 2007), remarkably few papers have been published since then on how to reliably assess the suitability of disinfectants.
This study was conducted to estimate the efficacy of some widely used disinfectant in Egyptian market as coccidiocidal disinfectant on E. tenellaoocysts in vitro.
MATERIALS AND METHODS
EimeriaOocysts Multiple oocysts isolates were obtained from ceci of clinically diseased native breeds chickens (25-40 days old) from different local farms in Assiut, Chickens suffered from depression, ruffled feathers, poor performance and with or without bloody faecal matter. The oocysts harvested from caecal contents and purified by using flotation technique. Oocysts were counted using MacMasterslide, and the number of oocysts was adjusted to 25000 oocysts per ml (Nematollahiet al., 2008).
Morphological identification Isolates used for morphological determination were chosen to be mostly consisted of oocysts that are morphologically similar to E.tenellaOocysts morphology and size were determined by measuring length and width of 50 similar oocysts using ocular micrometer.
Molecular identification of Eimeria species To confirm the presence of E.tenella in the examined isolates, the purified isolates containing aliquots of ~1 × 106oocysts were taken and oocysts were centrifugated at 2,000 rpm for 2 min. The genomic DNA extracted as per kit protocol, using Gene jet DNA and RNA purification kit (thermo scientific). PCR with the SCAR primers for E. tenella; F CCGCCCAAACCAGGTGTCACG and R CCGCCCAAACATGCAAGATGGC were carried out with a thermocycler adjusted as follow: Standardized cycling conditions consisted of initial denaturation: 96 °C for 5 min, (denaturation: 94 °C for 1 min, annealing: 62 °C for 2 min, extension: 72 °C for 1 min) for 30 cycles and Final extension: 72 °C for 7 min. All PCR products were analyzed by separation on 1.5% agarose gel in TAE buffer at 100 V for 30 min, were stained with ethidium bromide, and examined under UV light.
Disinfectants: Four different disinfectants were obtained from Kilcocompany for veterinary disinfectants (Kilco International Ltd, Northern Ireland)with a different active principle each as follow:
Chlorocresol was obtained as 100% concentrated crystals, then two dilutions 10% and 20% were prepared by adding 10gm of chlorocresol to 100 ml Ether and by adding 20gm of chlorocresol to 100 ml Ether, respectively. Quaternary ammonium compounds (QACs) was obtained as 100% concentrated solution, then two dilutions 2% and 4% were prepared by adding 2ml of QACs to 100 ml water and by adding 4ml of QACs to 100 ml water respectively.
Glutaraldehyde (50%) solution was used at concentrations 2% and 4%.kilcox Extra (a commercial product from Kilcocompany), it was used at concentrations 2% and 4%. Contains.
Isolates were divided into two Parts, first was subjected to different concentrations and contact times of the disinfectants, and then allowed to sporulate in potassium dichromate (2.5%) in petri-dishes.
The second part was allowed to sporulate by adding amount of potassium dichromate (2.5%) in petri-dishes. The Petri-dishes were semi-covered and kept at room temperature(25-28oC) for 3-5 days(Conway and McKenzie, 2007)and then subjected to different concentrations and contact times to the disinfectants after sporulation to evaluate the destructive activity of each disinfectant.
Both sporulated and unsporulatedoocysts were subjected to the following protocols according to (Junior et al., 2007).
sporulation percentage and sporulation inhibition activity
Sporulation percentage (SP) was calculated after 7 days to get the percentage of Sporulation inhibition activity (IA) of the oocysts and were calculated according to (junior et al., 2007)
IA% = {(sporulation % of control – sporulation % of disinfectant treated oocysts) X 100} sporulation % of control.
RESULTS
On gross lesion examination of the intestinal tract especially the two caecal lesions showed haemorrhages & clotted blood in caecal pouches. Figure (1)
figure legends, and tables: Figure 1: Two caeci of infected chicken showing bloody contents. Figure 2: Eimeriatenellaoocysts in wet smear (10x objective lens). Figure 3: lane 4 control positive for E. tenella 539bp and lane 5 pool positive for (E. tenella 539bp). Figure 4: inhibitory activity of disinfectants on unsporulatedoocysts. Figure 5: effect of disinfectants on sporulatedoocysts. Table 1: The inhibitory activity of disinfectants on unsporulatedoocysts.
Morphological identification: Microscopical identification of Eimeriaoocyst species revealed that 90.25% of collected samples were found infected with E. tenella. Figure (2)
Figure (2):Eimeriatenellaoocysts in wet smear (10x objective lens)
Molecular identification of Eimeria species: Thepresence of E. tenellaoocysts in the examined samples was confirmed by the detection of the amplified fragment (539 bp). Figure (3)
Figure (3):lane 4 control positive for E. tenella 539bp and lane 5 pool positive for (E. tenella 539bp)
The efficacy of disinfectants on E.tenellaoocysts: The inhibitory and destructive effect of different disinfectants on unsporulated and sporulatedE. tenellaoocysts were tabulated in tables 1 & 2.
Table 1: The inhibitory activity (IA) of disinfectants on unsporulatedoocysts.
C.T.=contact time SP%= sporulation percentage IA%= inhibitory activity
Results in Table (1) illustrated that the IA of four disinfectants against unsporulatedE. tenellaoocysts, kilcox (4%) was highly effective against unsporulatedE. tenellaoocysts at C.T of 30 and 120 minutes where the IA reached 99 % and 100 %, respectively. While the effect of lower concentration (2 %) for C.T of 30 and 120 minutes reached 97.3 % and 98 %, respectively.
The IA of Quaternary ammonium compound (QACs) on E. tenellaunsporulatedoocysts at 2% solution for 30 and 120 minutes C.T. resulted 76.3% and 91.8% IA and when we used 4% solution of QACs recorded good efficacy 88.1% and 93.9% respectively.
The effect of 2% solution of Glutaraldehyde at 30 and 120 minutes C.T. against the unsporulatedoocysts resulted 61.7% and 76.6% IA. And usage of 4% solution of Glutaraldehyde resulted 81.8% and 94.8%.
The usage of 10% solution of chlorocresol against unsporulatedoocysts at 30 and 120 minutes C.T. resulted 86.7% and 90.7% IA respectively, at 20% conc. the results were 92.7% and 94%.
Table 2: The destructive activity of disinfectants on sporulatedoocysts
On other hand the obtained results in table (2) documented the destructive activity of the examined disinfectants on sporulatedoocysts, the destructive effect of kilcox concentrations 4% against sporulatedoocysts at 30 and 120 minutes reached 93 % and 99 %, respectively.
Usage of 2% QACs solution at 30 and 120 minutes C.T. their (DE) was 53.6% and 66%, consequently, whilethe usage of 4% solution of QACs at 30 and 120 minutes C.T. resulted in (DE) 59% and 69%, respectively.
2% solution of glutaraldehyde at 30 and 120 minutes C.T. able to induce lysis of 21.5% and 49% of treated oocysts, respectively.whileat 4% conc. 30 and 120 minutes C.T. the result were 66.7% and 89%, respectively.
The usage of 10% solution of chlorocresol at 30 and 120 minutes C.T. resulted indestruction activity by 60% and 77%, respectively. At 20% conc. the results were 85% and 98%.
The findings obtained illustrated the powerful effect of Kilcox against sporulatedoocysts. DISCUSSION
From the viewpoint of coccidia control inactivation of exogenous stages of parasites is important for reducing infection pressure and protecting hosts from disease. Many commercial chemical disinfections eliminate bacteria or virus particles but don’t have inadequate or unknown anticoccidial properties (Daugschieset al., 2013).
The present research tested the ability of four chemical disinfectants to stop oocysts sporulation after in vitro incubation, and the effect of concentration and contact time (C.T) on efficacy of tested disinfectants against E. tenellaoocysts.
Firstly,it was observed that the effect of different disinfectants on unsporulatedoocycts was nearly convergent this may be due to absence of the double cell wall which facilitate the action of disinfectants, firstly Chlorocresol in high concentration was highly effective against unsporulatedE. tenellaoocysts at C.T of 30 and 120 minutes where the IA reached 99 % and 100 %, respectively. The obtained results revealed also the powerful destructive effect of kilcox concentrations 4% against sporulatedoocysts at 30 and 120 minutes reached 93 % and 99 %, respectively.
Concerning to Quaternary ammonium compound (QACs): its IA on E. tenellaunsporulatedoocysts at 4% solution recorded good efficacy 88.1% and 93.9% respectively.additionally, it was found that the efficacy was improved as the contact time increased.This result may be due to QACs were lipophilic compounds so; it may work on the oocyst wall so increasing concentration and/or CT leads to increasing of IA that agreed with (Bessems, 1998). Also, National Seafood HACCP Alliance, (2000) mentioned that QACs required a relatively long contact time to achieve significant kill.
In contrast, the disinfection efficacy (DE) of QACs on sporulatedoocysts is much lower than other disinfectants.
Data tabulated in table (1) also showed that the effect of high concentration 4% solution of Glutaraldehyde against the unsporulatedoocysts having good efficacy against the unsporulatedoocysts. regardingits effect on sporulatedoocysts, it was observed that the efficacy was increased by increasing the contact time, as the best result was obtained at 120 minutes contact time.
The usage of 20% solution of chlorocresol against both unsporulatedand sporulatedoocysts assessed good efficacy and powerful effect of chlorocresol.Similar results were obtained by (Straberg and Daugschies, 2007) and (You and Korean, 2014) who observed that cresol effectively inhibited sporulation up to 85.5%. While the obtained results were higher than that obtained by Oliveira, et al. (2004) who treated the oocysts of E. tenella, E. acervulina and E. maxima species with phenol 10.5% + Chlorocresol 10.5% at exposure time of 30 minutes and recorded only 7.7% IA. Daugschieset al. (2007) showed completely destroyed oocysts after acontact time of 90 min or more with the cresol-based products.
The present study cleared presence of differences between effect of the most tested disinfectants against unsporulated and sporulatedoocysts. Williams (1997) indicated that unsporulatedoocysts are more susceptible to disinfectants than sporulated one.
According to Daugschieset al. (2002) an inhibitory activity (IA) of at least 95% was required for certification of sufficient disinfecting efficacy by the German Veterinary Society. For which, Chlorocresol is considered the best chemical disinfectant against unsporulated and sporulatedE. tenellaoocysts in vitro in the present study.
CONCLUSION
From this study, it can be concluded that, a) disinfectant efficiency was conditioned by the disinfectant concentration and its exposure time to the oocysts. b) the most effective disinfectants against unsporulated and sporulatedE. tenellaoocysts was kilcox followed by chlorocresol, while QACS and, glutaraldehyde was less effective. c) in practical application of any disinfectant we should care to other environmental factors that can interact with the effect of disinfectants.
CONFLICT OF INTEREST STATEMENT
The authors declare that they have no conflict of interest.
ACKNOWLEDGMENT
The authors appreciated many greats for prof. dr. Mohsen Arafa for continuous helping.
REFERENCES
Abd El-Gawad, A.;Olfat A.; El-Massry, Aida, A. and Al-Aziz, MS. (2012): Studies on Coccidia of Egyptian Balady Breed Chickens. Life Sci., 9 (3): 568-576. Allen, PC.andFetterer, RH. (2002): Recent Advances in Biology and Immunobiology of Eimeria Species and in Diagnosis and Control of Infection with These Coccidian Parasites of Poultry. Clin. Microbiol. J. 15 (1), 58-65. Bessems, E. (1998):The effect of practical conditions on the efficacy of disinfectants. Int. Biodeterioration& Biodegradation 41: 177-183. Conway, DP.and McKenzie Elizabeth, M. (2007): Poultry Coccidiosis. Diagnostic and Testing Procedures. 3rd ED, Blackwell Publishing Professional. Daugschies, A.;Bangoura, B. andLendner, M. (2013): Inactivation of Exogenous Endoparasite Stages by Chemical Disinfectants: Current State and Perspectives. Parasitol Res. 2013 Mar;112(3):917-32. Daugschies, A.;Agneessens, J.;Goossens, L.;Mengel, H. andVeys, P. (2007): The effect of a metaphylactic treatment with diclazuril (Vecoxan®) on the oocyst excretion and growth performance of calves exposed to a natural Eimeriainfection. Veterinary Parasitology; 149: 199-206. Daugschies, A.; Bose, R.; Marx, J.;Teich, K. and Friedhoff, KT. (2002): Development and application of standardized assay for chemical disinfection of coccidiaoocysts. Veterinary Parasitology, v. 103, n. 4, p. 299-308. Fayer, R. (1980): Epidemiology of protozoan infections: The Coccidia. Veterinary Parasitology, v.6, n. 1-3, p. 75-103. Greif, G.;Froyman, R.; Ortiz, C.; Renner, GF.;Exner, O.; Schlegel, D. and matysiak, R. (2011): United States. Patent Application Publication. Disinfectants. US 2011/0086823 AI. Junior,JS.;Bogado, AL.; Da Cunha, TC.and Garcia, JL. (2007): In vitro evaluation of the disinfection efficacy on Eimeriatenellaunsporulatedoocysts isolated from broilers. Rev. Bras. Parasitol. Vet., 16(2): 67-71. Mahareek, RM. (1992): Therapeutic Efficacy of Anticoccidial Drugs. M.V.Sc. Thesis, Faculty of Vet. Med. Assiut University. National Seafood HACCP Alliance (2000): Sanitation Control Procedures for Processing Fish and Fishery Products, First edition January 2000, 203 pages. Nematollahi, A.;Moghaddam,Gh. andNiyazpour, F. (2008): Prevalence of Eimeria sp. among broiler chicks in Tabriz (Northwest of Iran). Res. J. poult. Sci., 2 (3):72-74. Oliveira, MR.;Longhi, E.; Ono,LM.;Zulpo, DL.andPeretti, J. (2004):Eficácia de inibição da esporulaçãoemoocistos de Eimeria de avestratados com desinfetantes de usocomercial. In: ENCONTRO ANUAL DE INICIAÇÃO CIENTÃFICA, 13, 2004, Londrina. Anais. Londrina: UEL, 2004. Reid, XM.;Mcdougald, LR.;Calnek, BW.; Barnes, HJ.; Beard, CW.; Eid, WM. and Yoder, JR. (1991):Coccidiosis. In Diseases of Poultry, 9 ed. Ames: Iowa State University Press. 780-792. Straberg, E. and Daugschies, A. (2007): Control of Piglet Coccidiosis by Chemical Disinfection with a Cresol-Based Product (Neopredisan) Para. sitol. Res. 101:599–604. Williams, RB. (1997):Laboratory tests of phenolic disinfectants asoocysticides against the chicken coccidiumEimeriatenella. Veterinary Record, v. 141, n. 17, p. 447-448. You, M. and Korean, J. (2014): Suppression of Eimeriatenella sporulation by disinfectants. Parasitol. J. 52(4):435-8.
کفاءة أربع مطهرات ضد معزولات الايميريا تينيلا من الدجاج المصري (تقييم معملي)
شيم الشري ، محمد احمد علي ، محمد عادل سليمان ،مديحة درويش ، عمر أمين
E-mail:drmohamed.soliman@mu.edu.egAssiut University web-site: www.aun.edu.eg
يعتبر طفيل الکوکسيديا من أخطر الطفيليات التي تصيب الدواجن وکذلک أنواع الطيور الأخرى مسببة الکثير من الخسائر الاقتصادية في صناعة الدواجن. وتعتمد مقاومة الکوکسيديا على عدة طرق من أهمها الرعاية الجيدة داخل العنابر والاهتمام بالفرشة واستخدام التحصينات والأدوية المناسبة بالإضافة الى استخدام المطهرات المختلفة داخل عنابر الدواجن من اجل السيطرة على الطفيل.
الهدف من هذه الدراسة هو التقييم المعملي لکفاءة أربعة مطهرات وهي مرکبات رباعي الامونيوم والجلوترالدهيد والکلوروکريسول والکيل کوکس ضد بويضات طفيل الکوکسيديا (الايميريا تينيلا) المعزولة من دجاج بلدي بمحافظة أسيوط.
تم تقييم کفاءة المطهرات باستخدامها ضد بويضات الايميريا الغير متحوصلة وکذلک ضد البويضات المتحوصلة وذلک بتعريض البويضات للمطهرات الاربعه کلا على حدى عند ترکيزات مختلفة وکذلک عند زمن تلامس مختلف وتقييم التاثير التدميري للمطهر على البويضات وکذلک تقييم قدرة المطهر على منع التحوصل.
وکانت النتائج کلاتي أفضل النتائج حصلنا عليها عند استخدام الکيل کوکس ثم الکلوروکريسول يتبعه مرکبات رباعي الامونيوم وأخيرا الجلوترالدهيد. ويتاکد من الدراسة ان زيادة الترکيز وزمن التعرض تزيد من کفاءة المطهرات وتأثيرها على بويضات الطفيل.
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
References | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
REFERENCES
Abd El-Gawad, A.;Olfat A.; El-Massry, Aida, A. and Al-Aziz, MS. (2012): Studies on Coccidia of Egyptian Balady Breed Chickens. Life Sci., 9 (3): 568-576.
Allen, PC.andFetterer, RH. (2002): Recent Advances in Biology and Immunobiology of Eimeria Species and in Diagnosis and Control of Infection with These Coccidian Parasites of Poultry. Clin. Microbiol. J. 15 (1), 58-65.
Bessems, E. (1998):The effect of practical conditions on the efficacy of disinfectants. Int. Biodeterioration& Biodegradation 41: 177-183.
Conway, DP.and McKenzie Elizabeth, M. (2007): Poultry Coccidiosis. Diagnostic and Testing Procedures. 3rd ED, Blackwell Publishing Professional.
Daugschies, A.;Bangoura, B. andLendner, M. (2013): Inactivation of Exogenous Endoparasite Stages by Chemical Disinfectants: Current State and Perspectives. Parasitol Res. 2013 Mar;112(3):917-32.
Daugschies, A.;Agneessens, J.;Goossens, L.;Mengel, H. andVeys, P. (2007): The effect of a metaphylactic treatment with diclazuril (Vecoxan®) on the oocyst excretion and growth performance of calves exposed to a natural Eimeriainfection. Veterinary Parasitology; 149: 199-206.
Daugschies, A.; Bose, R.; Marx, J.;Teich, K. and Friedhoff, KT. (2002): Development and application of standardized assay for chemical disinfection of coccidiaoocysts. Veterinary Parasitology, v. 103, n. 4, p. 299-308.
Fayer, R. (1980): Epidemiology of protozoan infections: The Coccidia. Veterinary Parasitology, v.6, n. 1-3, p. 75-103.
Greif, G.;Froyman, R.; Ortiz, C.; Renner, GF.;Exner, O.; Schlegel, D. and matysiak, R. (2011): United States. Patent Application Publication. Disinfectants. US 2011/0086823 AI.
Junior,JS.;Bogado, AL.; Da Cunha, TC.and Garcia, JL. (2007): In vitro evaluation of the disinfection efficacy on Eimeriatenellaunsporulatedoocysts isolated from broilers. Rev. Bras. Parasitol. Vet., 16(2): 67-71.
Mahareek, RM. (1992): Therapeutic Efficacy of Anticoccidial Drugs. M.V.Sc. Thesis, Faculty of Vet. Med. Assiut University.
National Seafood HACCP Alliance (2000): Sanitation Control Procedures for Processing Fish and Fishery Products, First edition January 2000, 203 pages.
Nematollahi, A.;Moghaddam,Gh. andNiyazpour, F. (2008): Prevalence of Eimeria sp. among broiler chicks in Tabriz (Northwest of Iran). Res. J. poult. Sci., 2 (3):72-74.
Oliveira, MR.;Longhi, E.; Ono,LM.;Zulpo, DL.andPeretti, J. (2004):Eficácia de inibição da esporulaçãoemoocistos de Eimeria de avestratados com desinfetantes de usocomercial. In: ENCONTRO ANUAL DE INICIAÇÃO CIENTÃFICA, 13, 2004, Londrina. Anais. Londrina: UEL, 2004.
Reid, XM.;Mcdougald, LR.;Calnek, BW.; Barnes, HJ.; Beard, CW.; Eid, WM. and Yoder, JR. (1991):Coccidiosis. In Diseases of Poultry, 9 ed. Ames: Iowa State University Press. 780-792.
Straberg, E. and Daugschies, A. (2007): Control of Piglet Coccidiosis by Chemical Disinfection with a Cresol-Based Product (Neopredisan) Para. sitol. Res. 101:599–604.
Williams, RB. (1997):Laboratory tests of phenolic disinfectants asoocysticides against the chicken coccidiumEimeriatenella. Veterinary Record, v. 141, n. 17, p. 447-448.
You, M. and Korean, J. (2014): Suppression of Eimeriatenella sporulation by disinfectants. Parasitol. J. 52(4):435-8. | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Statistics Article View: 1,147 PDF Download: 1,342 |