Nasal Carriage and Molecular Characterization of Methicillin-Resistant Staphylococcus aureus from Healthcare Workers and Community People in Minia City, Upper Egypt

Mohamed, Heba A; Mahmoud, Gamal F; Abdalla, Salah M; Mandour, Sahar A; Mohamed, Fatma Y

doi:10.21608/aeji.2025.336578.1429

Nasal Carriage and Molecular Characterization of Methicillin-Resistant Staphylococcus aureus from Healthcare Workers and Community People in Minia City, Upper Egypt

Afro-Egyptian Journal of Infectious and Endemic Diseases

Article 6, Volume 15, Issue 2, June 2025, Pages 159-168 PDF (370.91 K)

Document Type: Original Article

DOI: 10.21608/aeji.2025.336578.1429

Authors

Heba A Mohamed^* ¹; Gamal F Mahmoud¹; Salah M Abdalla²; Sahar A Mandour³; Fatma Y Mohamed³

¹Department of Microbiology and Immunology, Faculty of Pharmacy, Minia University, Minia, Egypt

²Department of Microbiology and Immunology, Faculty of Pharmacy, Suez Canal University, Ismailia, Egypt

³Department of Microbiology and Immunology, Faculty of Pharmacy, Deraya University, Minia, Egypt

Abstract

Background and study aim: Human anterior nares can be colonized by Staphylococcus aureus, which represents a great risk of developing invasive infections. This study aimed to assess resistance profiles and the prevalence of resistance genes in Staph aureus strains isolated from nasal swabs of healthcare workers and community people.
Patients and Methods: two hundred and thirty-three nasal specimens were collected from both healthcare workers and community people in Minia City. S. aureus was identified by conventional methods. Antibiotic sensitivity testing was done using the Kirby-Bauer Disk Diffusion assay. Screening of virulent genes including (mec A, pvl, hla, seb, fnbA, icaA and tsst-1) was done using polymerase chain reaction (PCR).
Results: A total of 95 S. aureus isolates were recovered, 46 (48.4%) were isolated from healthcare workers and 49 (51.6%) from community people. Virulence genes mec A, hla, fnbA, and seb were detected in all-positive strains as follows: 14 (48.3%), 10 (34.5%), 4 (13.8%), and 2 (6.9%) respectively. Virulence genes (mec A hla, fnbA, and seb genes) were more detected among S. aureus isolates of community people than those nasally harbored by healthcare workers. The Ica A gene was only detected in healthcare workers' pvl-positive strains (8, 28%), while the tsst-1 gene wasn't detected among all S. aureus pvl-positive strains.
Conclusion: Nasal carriage of S. aureus were detected in both community people and health care workers, almost equally. Virulence genes (mec A, pvl, hla, fnbA, and seb genes) were more detected in strains isolated from community people than those isolated from healthcare workers.

Highlights

Human anterior nares is colonized by Staphylococcus aureus, this represents a great risk of developing invasive infections.
This study aimed to screen community people and healthcare workers for nasal carriage of staphylococcus aureus and to assess the incidence of virulence genes.
This study detected higher percentages of virulence genes in strains isolated from community people than those isolated from healthcare workers, which represents a public health problem.

Keywords

Staphylococcus aureus; nasal carriage; virulence genes

Full Text

INTRODUCTION

Staphylococcus aureus can be present in the human body as a member of the body flora [1] or as an opportunistic pathogenic bacteria that causes a variety of nosocomial and community diseases [2,3,4]. The nose (anterior nares) is considered the most common biological niche for S. aureus carriage in humans, due to the specific anatomy of this region facilitating the colonization of SA, however, this bacterium can colonize other body regions. These bacteria can live in the nasal cavity in about 20–30% of the human population asymptomatically and persistently [1]. However, ongoing S. aureus nasal colonization may raise the likelihood of subsequent infections [5], moreover, some studies relate S. aureus nasal carriage to some autoimmune diseases[6,7 ].Methicillin-resistant S. aureus (MRSA) infections were initially only found in hospitals, but they have since become a major source of community-acquired (CA) infections worldwide [8]. Extensive and repeated use of broad-spectrum antibiotics is the mandatory contributing factor to the rise in antimicrobial resistance of MRSA. The spread of multi-drug-resistant S. aureus strains, especially MRSA, complicates the treatment of staphylococcal infection and represents a significant economic problem[9].

In addition to antimicrobial resistance, genes involved in virulence are essential for the production of toxins and other substances that exacerbate illness. Increased pathogenicity and the risk of serious infections have been associated with the presence of particular virulence genes, including panton-valentine leucocidin (pvl), alpha-toxin (hla), and toxic shock syndrome toxin-1 (tsst-1) [10].

This study aimed to screen both healthcare workers and community people for nasal carriage of staph aureus, especially MRSA. In addition, this study was designed to investigate antibiotic resistance profiles and virulence genes (mec A, pvl, hla, seb, fnbA, tsst-1, and icaA) among the isolated strains.

METHODS

Sample Collection:

A total of 233 nasal specimens were taken from community people and healthcare workers of Minia University Hospital during the period between May 2021 to April 2022. All nasal swabs were streaked onto different media and incubated at 37^oC for 24 hours (11).

Isolation and Identification of S. aureus:

Specimens were identified microscopically and by conventional biochemical tests including Mannitol salt agar culture, catalase production test, coagulase test, and DNase production test [11].

Antibiotic susceptibility testing:

Antibiotic susceptibility was done using the Kirby-Bauer disc susceptibility technique [12], using a standard reference strain, S. aureusATCC (6538), and results were interpreted with the guidance of the Clinical Laboratory Standards Institute (CLSI 2020) [13].

The following 17 antibiotic discs obtained from (Oxoid, UK) were used: Ampicillin-Sulbactam (SAM:20 µg), Amoxicillin-Clavulanic (AMC:30 µg), Flucloxacillin (FL:5 µg), Oxacillin (OX:1 µg), Piperacillin-Tazobactam (TZP:110 µg), Vancomycin (VA:30 µg), Azithromycin (AZM:15 µg), Cephalexin (CL:30 µg), Cefoxitin (FOX:30 µg), Cefepime (FEP:30 µg), Cefaclor (CEC:30 µg), Gentamicin (CN:10 µg), Clindamycin (DA:2 µg), Ciprofloxacin (CIP:5 µg), Levofloxacin (LEV:5 µg), Linezolid (LNZ:30 µg), and Rifampicin (RA:5 µg).

Cefoxitin disc diffusion test:

Using a 30 μg disc, the test was performed on each isolate. The isolate was converted into a 0.5 McFarland standard, and grass culture was performed on the Mueller Hinton agar (MHA) plate. Zone diameters were measured after plates were incubated for eighteen hours at 37⁰C. Oxacillin resistance was defined as an inhibition zone diameterof less than 19 mm, whereas sensitivity to oxacillin was defined as a diameter of more than 20 mm [14].

PCR testing:

DNA Extraction: S. aureus genomic DNA was extracted using the boiling method [15], one to two colonies from overnight cultures were suspended in 500μl of sterile distilled water, then this mixture was boiled at 100 °C for fifteen minutes. After 5 minutes of 14,000 rpm centrifugation, 2μl of the supernatant was used as the genomic template for subsequent testing.

Polymerase Chain Reaction:

Table (1) listed the primers used in that study for the determination of genes encoding methicillin and penicillin-like antibiotics resistance (mec A), panton valentine leukocidin (pvl), toxic shock syndrome toxin ( tst-1), staphylococcal enterotoxin b (seb), fibronectin-binding protein A (FnbA), α-hemolysin (hla), and intracellular adhesion A (icaA). Table(2) illustrates the polymerase chain reaction (PCR) conditions using The DNA thermocycler.

Gel electrophoresis:

For visualizing the PCR products, 5 μl of the PCR amplicons were loaded in a (1.5) percent agarose gel containing fluorescent ethidium bromide dye (0.5 mg/ml, Medox Biotech India Pvt Ltd) and a molecular weight ladder (1500bp DNA marker; H3 ready to use, Gene Direx). After two hours of electrophoresis at 80 V, different amplified DNA samples were examined using a UV lamp set at 264 nm.

Statistical analysis:

The data were analyzed using χ2 using SPSS version25 (SPSS, Inc., Chicago, IL, USA). The results were considered significant when P ≤ 0.05.

RESULTS

Ninety-five (40.77%) S. aureus isolates were recovered from 233 collected nasal specimens, including 46 (48.4%) isolates from healthcare workers and 49 (51.6%) from community people. S. aureus was more prevalent in female patients than male ones.

It was observed that S. aureus and MRSA were highly detected in the age group of (21-30) years, while the lowest percentage of their isolation was detected in the age group between (0-10) as shown in (table 3).

Antibiotic susceptibility test:

Seventeen antibiotics were tested in this study on 95 (40.77%) S. aureus isolates, it was found that the highest resistance percentage of S. aureus isolates was to flucloxacillin for community isolates and to oxacillin for healthcare personnel staph isolates while the least resistance percentage was to clindamycin for all isolates. Table (4) and Fig. (1) showed the resistance pattern of S. aureus isolates, there was no significant difference between S. aureus resistance percentages from healthcare workers and community people for all tested antibiotics except for oxacillin.

Detection of MRSA:

Out of 95 S. aureus isolates, 59 (62.1%) strains were detected as methicillin-resistant staph aureus (MRSA) while 36 (37.9 %) isolates were methicillin-susceptible staph aureus (MSSA), this result was obtained by cefoxitin-resistance testing then confirmed by PCR test for mecA gene. It was detected in healthcare workers (30, 50.8%) more than in community people (29, 49.2%), table (5). In addition, MRSA was found in females (34, 57.6%) more than in males (20, 42.4%).

Virulence genes:

It was found that 29 (30.52%) S. aureus strains harbored pvl gene. Panton valentine leucocidin-positive S. aureus isolates were detected more detected in community people, 21(72.4%) than in healthcare workers, 8 (27.6%). Out of 29 community MRSA isolates in this study, there was a high prevalence of pvl (14, 48.27%), however, the prevalence of pvl among 30 MRSA isolated from healthcare workers was 5 (16.6%). The percentage of the pvl-positive MRSA was higher than the pvl-positive MSSA.

It was observed that the distribution of virulence genes among pvl positive strains was as follows: mec A, hla, fnbA, and seb genes were more detected in community people, they were detected in 14 (48.3%), 10 (34.5%), 4 (13.8%) and 2 (6.9%) respectively. Ica A gene was only detected in healthcare workers' pvl positive strains (8, 28%), while the tsst-1 gene wasn't detected among all S. aureus pvl positive strains as shown in Fig (2) and Table (6).

Table (1). sequences of primers

Genes	Primer sequence (5' to 3')	Amplicon size (bp)	References
Mec A1 (F)	GTA GAA ATG ACT GAA CGT CCG ATA A	310	(16)
Mec A2 (R)	CCA ATT CCA CAT TGT TTC GGT CTA A
Luk-PV-1 (F)	ATCATTAGGTAAAATGTCTGGACATGATCCA	433	(16) & (17)
Luk-PV-2 (R)	GCATCAAGTGTATTGGATAGCAAAAGC
hla (F)	CTGATT ACT ATC CAA GAA ATT CGA TTG	209	(18)
hla (R)	CTTTCC AGC CTA CTT TTT TAT CAG T
seb (F)	ACATGTAATTTTGATATTCGCACTG	667	(19)
seb (R)	TGCAGGCATCATGTCATACCA
fnbA (F)	GCG GAG ATC AAA GAC AA	1279	(20)
fnbA (R)	CCATCTATAGCTGTG TGG
tst (F)	ACCCCTGTTCCCTTATCATC	326	(21)
tst (R)	TTTTCAGTATTTGTAACGCC
icaA (F)	GATTATGTAATG TGCTTGGA	770	(18)
icaA (R)	ACTACT GCT GCG TTAATAAT

Table (2). PCR Amplification conditions

Genes

Denaturation

initially

Denaturation

Annealing

Extension

Finally

Cycles

(n)

Product size

(base pair)

References

Luk-PV

94 C

for 4 min

94 C

for 45 s

56 C

for 45 sec

72 °C

for 30 sec

72 °C

for 2 min

433 bp

(16)

Mec A

94 C

for 4 min

at 94 °C

for 45 s

56 C

for 45 s

72 C

for 30 s

72 °C

for 2 min

310 bp

(16 &(17)

Hla

95 °C

for 5 min

95 C

for 50 s

58 °C

for 30 sec

72 C

for 60 sec

72 °C

for 10 min

209 bp

(18)

Seb

95 C

for 5 min

95 °C

for 60 sec

55 °C

for 45 sec

72 C

for 60 sec

72 °C

for 10 min

667 bp

(19)

FnbA

95 C

for 5 min

95 °C

for 60 sec

47 °C

for 60 sec

72 °C

for 90 sec

72 °C

for 5 min

1279 bp

(20)

Tst

94 ̊ C

for 5 min

94 ̊C

for 60 sec

54 ̊C

for 60 sec

72 C

for 60 sec

72 ̊C

for 7 min

326 bp

(21)

ica A

95 °C

for 5 min

95 C

for 60 sec

50 °C

for 1 min

72 °C

for 1.5 min

72 °C

for 5 min

770 bp

(18)

Table (3). prevalence of Staph. aureus and MRSA according to age group.

Age group (years)	S. aureus isolates	MRSA
0-10	2 (2.1%)	1 (1.7%)
11-20	17 (17.9%)	14 (23.7%)
21-30	42 (44.2%)	26 (44.1%)
31-40	14 (14.7%)	8 (13.5%)
41-50	13 (13.7%)	9 (15.3%)
51-60	7 (7.4%)	1 (1.7%)

Table (4): Antibiotic susceptibility testing.

Antibiotic	Healthcare workers N=46			community N=49			P value
Antibiotic	S	I	R	S	I	R	P value
Amox- Clavulanic	18(39.1%)	0(0%)	28(60.9%))	18(36.7%))	0(0%)	31(63.3%))	0.810
Ampicillin- Sulbactam	20(43.5%)	0(0%)	26(56.5%)	24(49%)	0(0%)	25(51%)	0.591
Azithromycin	39(84.8%)	5(10.9%))	2(4.3%)	41(83.7%)	2(4.1%)	6(12.2%)	0.197
Cefaclor	7(15.2%)	6(13%)	33(71.7%)	8(16.3%)	4(8.2%)	37(75.5%)	0.740
Cefepim	30(65.2%)	0(0%)	16(34.8%)	27(55.1%)	0(0%)	22(44.9%)	0.315
Cefoxitin	17(37%)	0(0%)	29(63%)	19(38.8%)	0(0%)	30(61.2%)	0.855
Cephalexin	7(15.2%)	3(6.5%)	36(78.3%)	14(28.6%)	5(10.2%)	30(61.2%)	0.193
Ciprofloxacin	37(80.4%)	2(4.3%)	7(15.2%)	38(77.6%)	1(2%)	10(20.4%)	0.676
Clindamycin	42(91.3%)	4(8.7%)	0(0%)	40(81.6%)	8(16.3%)	1(2%)	0.318
Flucloxacillin	5(10.9%)	0(0%)	41(89.1%)	3(6.1%)	0(0%)	46(93.9%)	0.405
Gentamycin	38(82.6%)	1(2.2%)	7(15.2%)	40(81.6%)	4(8.2%)	5(10.2%)	0.351
Levofloxacin	40(87%)	1(2.2%)	5(10.9%)	40(81.6%)	2(4.1%)	7(14.3%)	0.751
Linezolid	44(95.7%)	0(0%)	2(4.3%)	42(85.7%)	0(0%)	7(14.3%)	0.098
Oxacillin	2(4.3%)	0(0%)	44(95.7%)	11(22.4%)	0(0%)	38(77.6%)	0.010*
Pipracillin- Tazopactam	35(76.1%)	0(0%)	11(23.9%)	36(73.5%)	0(0%)	13(26.5%)	0.769
Rifampin	30(65.2%)	6(13%)	10(21.7%)	33(67.3%)	6(12.2%)	10(20.4%)	0.976
Vancomycin	37(80.4%))	5(10.9%)	4(8.7%)	43(87.8%)	0(0%)	6(12.2%)	0.056

Chi-Square test, *: Significance at P value < 0.05, I: intermediate, S: sensitive R: resistant

Table (5). MRSA and MSSA distribution in community and health care workers.

*Total Staph aureus* isolates**		Community		Healthcare workers
95		49 (51.6%)		46 (48.4%)
MRSA	MSSA	MRSA	MSSA	MRSA	MSSA
59 (62.1%)	36 (37.9%)	29 (59.2%)	20 (40.8%)	30 (65.2%)	16 (34.8%)

Table (6): Distribution of virulence genes in MRSA and MSSA strains harboring pvl gene isolated from healthcare workers and community people.

Virulence gene	*Pvl + S. aureus* isolates (29)
	Healthcare workers (8)		Community (21)
	MRSA	MSSA	MRSA	MSSA
mec A	5	3	14	7
Hla	-	-	8	2
fnbA	-	-	4	-
Seb	-	-	2	-
Ica	5	3	-	-
tsst-1	-	-	-	-

DISCUSSION

Staph. Aureus is considered one of the leading causes of serious infections with bad prognosis and increased medical care costs. Compared to infections produced by (MSSA), MRSA infections are associated with higher rates of hospitalization, death, and morbidity. Virulence factors such as hemolysins (Hlα and Hlβ), Panton-Valentine leucocidin (pvl), fibronectin-binding proteins A (FnBPA) and B (FnBPB), and toxic shock syndrome toxin-1 (TSST-1), almost all of them contribute to the pathogen's capacity for adhesion, colonization, and tissue invasion, thus enhancing pathogenicity [22].

As far as we know, this is the first study to determine the nasal carriageof S. aureus as well as MRSA, and pvl gene rate among healthcare workers and community people in Egypt's Minia governorate.

In our findings, S. aureus was detected in 95 (40. 8%) nasal specimens consistent with that of Samsudin et al., [23] who revealed that 50.8% of isolates were S. aureus. On the other hand, our findings showed that the overall prevalence of nasal S. aureus was higherthan the results revealed by some previous studies [24], [25], [26] which showed that the distribution of S. aureus in nasal samples was (11%), (25.3%) and (26%) respectively.

Regarding gender, the overall incidence of staph aureus, especially MRSA nasal carriage was found higher in female swabs (57.6%) than in male swabs (42.4%), This finding is in line with the result obtained by Hogan et al., [24] who revealed that the incidence of MRSA was more common in women (12.7 %) than in men (8.0 %). A different result was obtained by Olsen et al., [26] and Abdel-Maksoud et al., [27] who noticed that MRSA nasal carriage was more prevalent in men than in women.

This study revealed that the distribution of S. aureus was (48.4%) and (51.6%) among healthcare workers and community people respectively, these results are in agreement with the results of Hogan et al., [24] who revealed that the distribution of S. aureus was(46.8%) and (53.2%) and among healthcare workers and community samples respectively. In contrast, Abdel-Maksoud et al., [27] reported that the incidence of Staphylococcus aureuswas higher among healthcare workers (71%) than that in the community (29%). Bettin et al., [28] found that S. aureus isolates among medical student samples were (22.1%).

The antimicrobial sensitivity test in this study showed that S. aureus isolates showed the least resistance to clindamycin (1.1%), this result is close to the results obtained by previous studies [28, 29, 30] that reported the high efficiency of clindamycin against S. aureus isolates.

Out of the 95 Staph. Aureus isolates, there were 59 (62.1%) isolates detected as MRSA while 36 (37.9 %) isolates were Methicillin-Susceptible (MSSA), which agrees with Song et al., [31], who recorded the prevalence of MRSA and MSSA by 58.1%, and 41.9% respectively. While Akhtar et al. [32] found that the incidence of MRSA was (45.3%).

Our study reported that S. aureus harboring pvl genes were present in 29 (30.52%) of total S. aureus isolates, this result is similar to Alli et al., [33] who reported (34.6%) pvl gene prevalence. Lower percentages (4.4%, 12.3%, and 8%) of S. aureus carrying the pvl gene were detected by Samsudin et al., [23], Darboe et al., [34] and Bhatta et al., [35] respectively. However, Hussein et al., [36] reported a higher incidence of the S. aureus harbored pvl genes (61.4%).

Our findings showed that 8 (17.4%) and 21 (42.9%) were the percentages of pvl gene incidence among healthcare workers and community people S. aureus isolates, these results conflict with the results obtained by Hogan et al., [24] and Akhtar et al., [32] who reported that the existence of pvl gene among healthcare workers and community people was (7.5%), (26%) and (11%), (13.8%) respectively.

The pvl gene prevalence among MRSA strains (32.2%) more than in MSSA strains (27.7%) and this result agree with the result found by Bettin et al., [28], Bhatta et al., [35] and Shrestha et al., [37] and opposite to the result found by Samsudin et al., [23], Pany et al., [38] and Tristan et al., [39] who reported that MSSA made up the high percentage of the pvl-positive isolates.

A high prevalence of pvl among CA MRSA isolates was detected at 48.27% (14/29) more than pvl in MRSA isolates from healthcare workers at 16.6% (5/30) and this result was somewhat similar to the result found by Bhatta et al., [35] who reported that existence of pvl gene within community-acquired MRSAstrains (16.7%) was higher than existence of pvl gene among healthcare workers MRSAstrains (7.3%).

Our study reported that the virulence genes mec A, hla, fnbA, and seb genes commonly distributed among community people-pvl harboring strains as 14 (48.3%), 10 (34.5%), 4 (13.8%), and 2 (6.9%) respectively, while ica A gene was more prevalent in healthcare workers pvl positive strains (28%). Akhtar et al., [32] reported a high prevalence of the fnb A gene. Moazen et al., [40] reported a low prevalence of the seb gene among S. aureus strains and this result is similar to our finding.

In this study, the tsst-1 gene was not detected among both healthcare workers and community people, this agrees with Moazen et al., [40], Machado et al., [41], and Li et al., [42], who reported a low prevalence of this gene.

Finally, our results revealed that the studied virulence genes were commonly distributed in MRSA harboring pvl gene more than MSSA-pvl positive strains, This is consistent with studies done by Song et al., [31] and Darboe et al., [34]. However, Machado et al., [41] found that the hla gene prevalence is more common in MSSA than in MRSA.

The differences between our results and other studies may be attributed to differences in geographical distribution. CONCLUSION:

Nasal carriage of S. aureus were detected in both community people and health care workers. Virulence genes (mec A, pvl, hla, fnbA, and seb genes) were more detected in strains isolated from community people than those isolated from healthcare workers.

Ethical approval:

The Human Research Ethics Committee at the Faculty of Pharmacy at the University of Deraya, Minia, Egypt, approved the study (Approval No 1/2018).

Conflict of Interest: The authors declare no conflict of interest.

Funding Sources: This research did not receive any specific grant from funding agencies in the public, commercial, or not-for-profit sectors.

Availability of data and materials

The datasets are available from the corresponding author upon reasonable request.

Author Contributions: Each author contributed to the project's planning, patient research, sample collection, data processing, or data interpretation. Each contributor contributed to the drafting and editing of the manuscript.

References

Krismer B, Weidenmaier C, Zipperer A, Peschel A. The commensal lifestyle of Staphylococcus aureus and its interactions with the nasal microbiota. Nat Rev Microbiol. 2017; 15 (11):675-87.
Lee AS, de Lencastre H, Garau J, Kluytmans J, Malhotra-Kumar S, Peschel A, et al. Methicillin-resistant Staphylococcus aureus. Nat Rev Dis Primers. 2018; 4:18033.
Mlynarczyk A, Szymanek-Majchrzak K, Grzybowska W, Durlik M, Deborska-Materkowska D, Paczek L, et al. Molecular and phenotypic characteristics of methicillin-resistant Staphylococcus aureus strains isolated from hospitalized patients in transplantation wards. Transplant Proc. 2014; 46(8):2579-82.
Wertheim HF, Melles DC, Vos MC, van Leeuwen W, van Belkum A, Verbrugh HA, et al. The role of nasal carriage in Staphylococcus aureus infections. Lancet Infect Dis. 2005; 5(12):751-62.
Young BC, Wu C-H, Gordon NC, Cole K, Price JR, Liu E, et al. Severe infections emerge from commensal bacteria by adaptive evolution. eLife. 2017;6:e30637.
McLean MH, Dieguez D, Jr., Miller LM, Young HA. Does the microbiota play a role in the pathogenesis of autoimmune diseases? Gut. 2015;64(2):332-41.
Conti F, Ceccarelli F, Iaiani G, Perricone C, Giordano A, Amori L, et al. Association between Staphylococcus aureus nasal carriage and disease phenotype in patients affected by systemic lupus erythematosus. Arthritis Res Ther. 2016; 18:177.
Miller LG, Quan C, Shay A, Mostafaie K, Bharadwa K, Tan N, et al. A Prospective Investigation of Outcomes after Hospital Discharge for Endemic, Community-Acquired Methicillin-Resistant and -Susceptible Staphylococcus aureus Skin Infection. Clin Infect Dis. 2007;44(4):483-92.
Mrochen DM, Fernandes de Oliveira LM, Raafat D, Holtfreter S. Staphylococcus aureus Host Tropism and Its Implications for Murine Infection Models. Int J Mol Sci 2020;21(19).
Moazen J, Riyahi Zaniani F, Raje R. Characterization of Staphylococcus aureus Nasal Carriage Among Healthcare Providers in an Intensive Care Unit: Insights into Antibiotic Resistance Profiles and Virulence Gene Distribution. Arch Clin Infect Dis. 2023;18(6):e137545.
Hall GSJL. Bailey & Scott’s Diagnostic Microbiology, 13th Edn. 2013;44.
Bauer AW, Kirby WMM, Sherris JC, Turck M. Antibiotic Susceptibility Testing by a Standardized Single Disk Method. Am J Clin Pathol. 1966; 45(4):493-6.
Kosikowska U, Andrzejczuk S, Grywalska E, Chwiejczak E, Winiarczyk S, Pietras-Ożga D, et al. Prevalence of susceptibility patterns of opportunistic bacteria in line with CLSI or EUCAST among Haemophilus parainfluenzae isolated from respiratory microbiota. Sci Rep. 2020; 10(1):1-11.
Brown DF, Edwards DI, Hawkey PM, Morrison D, Ridgway GL, Towner KJ, et al. Guidelines for the laboratory diagnosis and susceptibility testing of methicillin-resistant Staphylococcus aureus (MRSA). J Antimicrob Chemother. 2005; 56(6):1000-18.
Amin DHM, Guler E, Baddal B. Prevalence of Panton-Valentine leukocidin in methicillin-resistant Staphylococcus aureus clinical isolates at a university hospital in Northern Cyprus: a pilot study. BMC Res Notes 2020;13(1):490.
Bhatta DR, Cavaco LM, Nath G, Kumar K, Gaur A, Gokhale S, et al. Association of Panton-Valentine Leukocidin (PVL) genes with methicillin-resistant Staphylococcus aureus (MRSA) in Western Nepal: a matter of concern for community infections (a hospital-based prospective study). BMC infects dis. 2016; 16: 199.
Hesari MR, Salehzadeh A, Darsanaki RK. Prevalence and molecular typing of methicillin-resistant Staphylococcus aureus carrying Panton-Valentine leukocidin gene. Acta Microbiol Immunol Hung. 2018; 65(1):93-106.
Rasmi AH, Ahmed EF, Darwish AMA, Gad GFM. Virulence genes distributed among Staphylococcus aureus causing wound infections and their correlation to antibiotic resistance. BMC infects dis. 2022; 22(1):652.
Sauer P, Síla J, Štosová T, Večeřová R, Hejnar P, Vágnerová I, et al. Prevalence of genes encoding extracellular virulence factors among meticillin-resistant Staphylococcus aureus isolates from the University Hospital, Olomouc, Czech Republic. J med microbiol. 2008; 57(4):403-10.
Nashev D, Toshkova K, Salasia SI, Hassan AA, Lämmler C, Zschöck M. Distribution of virulence genes of Staphylococcus aureus isolated from stable nasal carriers. FEMS Microbiol Lett. 2004; 233(1):45-52.
Rasheed NA, Hussein NR. Characterization of different virulent factors in methicillin-resistant Staphylococcus aureus isolates recovered from Iraqis and Syrian refugees in Duhok city, Iraq. PloS one. 2020; 15(8): e0237714.
Onanuga A, Adamu OJ, Odetoyin B, Hamza ja. Nasal Carriage of Multi-Drug Resistant Panton Valentine Leukocidin Positive Staphylococcus Aureus In Healthy Individuals of Tudun-Wada, Gombe State, Nigeria. Afr J infect dis. 2021; 15(1):24-33.
Samsudin S, Al-Talib H, Zain ZM. Distribution of Panton-Valentine Leukocidin Positive Staphylococcus aureus Nasal Carriers among Patients and Nurses in Tertiary Hospital-Malaysia: Staphylococcus aureus Nasal Carriers among Patients and Nurses. J Med Health Sci. 2021; 3(1).
Hogan B, Rakotozandrindrainy R, Al-Emran H, Dekker D, Hahn A, Jaeger A, et al. Prevalence of nasal colonization by methicillin-sensitive and methicillin-resistant Staphylococcus aureus among healthcare workers and students in Madagascar. BMC Infect Dis. 2016;16(1):1-9.
Zakai SA. Prevalence of methicillin-resistant Staphylococcus aureus nasal colonization among medical students in Jeddah, Saudi Arabia. Saudi Med J 2015; 36(7):807.
Olsen K, Sangvik M, Simonsen GS, Sollid JUE, Sundsfjord A, Thune I, et al. Prevalence and population structure of Staphylococcus aureus nasal carriage in healthcare workers in a general population. The Tromsø Staph and Skin Study. Epidemiol Infect. 2013;141(1):143-52.
Abdel-Maksoud M, El-Shokry M, Ismail G, Hafez S, El-Kholy A, Attia E, et al. Methicillin-resistant Staphylococcus aureus recovered from healthcare and community-associated infections in Egypt. Int J Bacteriol 2016; 2016.
Bettin A, Causil C, Reyes N. Molecular identification and antimicrobial susceptibility of Staphylococcus aureus nasal isolates from medical students in Cartagena, Colombia. Braz J Infect Dis. 2012; 16: 329-34.
Dilnessa T, Bitew A. Prevalence and antimicrobial susceptibility pattern of methicillin-resistant Staphylococcus aureus isolated from clinical samples at Yekatit 12 Hospital Medical College, Addis Ababa, Ethiopia. BMC infects dis. 2016;16(1):1-9.
Djoudi F, Bonura C, Benallaoua S, Touati A, Touati D, Aleo A, et al. Panton-Valentine leukocidin positive sequence type 80 methicillin-resistant Staphylococcus aureus carrying a staphylococcal cassette chromosome mec type IVc is dominant in neonates and children in an Algiers hospital. New Microbiol. 2013;36(1):49-55.
Song WC, Zhang SS, Gong YH. Distribution and drug resistance profile of methicillin-resistant Staphylococcus aureus after orthopedic surgery. Distribution and drug resistance profile of methicillin-resistant Staphylococcus aureus after orthopedic surgery. Pak J Pharm Sci. 2015; 28.
Akhtar Danesh L, Saiedi Nejad Z, Sarmadian H, Fooladvand S, van Belkum A, Ghaznavi-Rad E. Elimination of Staphylococcus aureus nasal carriage in intensive care patients lowers infection rates. Eur J Clin Microbiol Infect Dis. 2020; 39(2):333-8.
Alli OAT, Ogbolu DO, Shittu AO, Okorie AN, Akinola JO, Daniel JB. Association of virulence genes with mecA gene in Staphylococcus aureus isolates from Tertiary Hospitals in Nigeria. Indian J Pathol Microbiol. 2015;58(4):464.
Darboe S, Dobreniecki S, Jarju S, Jallow M, Mohammed NI, Wathuo M, et al. Prevalence of Panton-Valentine leukocidin (PVL) and antimicrobial resistance in community-acquired clinical Staphylococcus aureus in an urban Gambian hospital: 11 years retrospective pilot study. Front Cell Infect Microbiol. 2019;9:170.
Bhatta DR, Cavaco LM, Nath G, Kumar K, Gaur A, Gokhale S, et al. Association of Panton-Valentine Leukocidin (PVL) genes with methicillin-resistant Staphylococcus aureus (MRSA) in Western Nepal: a matter of concern for community infections (a hospital-based prospective study). BMC infects dis. 2016; 16(1):1-6.
Hussein N, Salih RS, Rasheed NA. Prevalence of methicillin-resistant Staphylococcus aureus in hospitals and community in Duhok, Kurdistan region of Iraq. Intern J Infect. 2019;6(2).
Shrestha B, Singh W, Raj VS, Pokhrel BM, Mohapatra TM. High prevalence of Panton-Valentine leukocidin (PVL) genes in nosocomial-acquired Staphylococcus aureus isolated from tertiary care hospitals in Nepal. Biomed Res Int. 2014;2014.
Pany S, Sharma BM, Sen SK, Pal BB. Association of PVL Gene in MSSA and MRSA Strains among Diabetic Ulcer Patients from Odisha, India. Int J Low Extrem Wounds. 2022:15347346221091355.
Tristan A, Ferry T, Durand G, Dauwalder O, Bes M, Lina G, et al. Virulence determinants in community and hospital methicillin-resistant Staphylococcus aureus. J Hosp Infect. 2007; 65:105-9.
Moazen, J., Zaniani F. R. & Asghar B. H. (2022) Characterization of Virulence Genes and Antibiotic Resistance of Methicillin-resistant Staphylococcus aureus (MRSA) and Methicillin-susceptible Staphylococcus aureus (MSSA) Isolates in Intensive Care Unit (ICU) and Non-ICU Wards. Trends in Med Sci, 2022; 2: e129037.
Machado TS, Pinheiro FR, Andre LSP, Pereira RFA, Correa RF, de Mello GC, et al. Virulence factors are found in nasal colonization and infection of methicillin-resistant Staphylococcus aureus (MRSA) isolates and their ability to form a biofilm. Toxins. 2020;13(1):14.
Li S, Wang P, Zhao J, Zhou L, Zhang P, Fu C, et al. Characterization of toxin genes and antimicrobial susceptibility of Staphylococcus aureus from retail raw chicken meat. J food protect. 2018; 81(4):528-33.

Statistics

Article View: 200

PDF Download: 148