MOLECULAR BIOLOGICAL STUDIES ON
TRANSCRIPTION FACTOR ESTROGEN-RECEPTOR
IN BREAST CANCER TREATED WITH LECTIN
Mohamed El-Shal1 ; Ibrahim El-Sayed2 ; Wael S. Abdel-Mageed3;
Mahmoud E. Gadalla4 and Norhan M. Eid1
1. Molecular Biology Department, Genetic Engineering and Biotechnology Research
Institute, University of Sadat City, Egypt.
2. Chemistry Department, Faculty of Science, Kafrelsheikh University, Egypt.
3. Genetics Department, Faculty of Agriculture, Beni-Suef University, Egypt.
4. Molecular diagnosis Department, Genetic Engineering and Biotechnology Research
Institute, University of Sadat City, Egypt.
Corresponding Author:
Mohamed F. Elshal., Ph.D., Department of Molecular Biology, Genetic Engineering
and Biotechnology Research Institute, University of Sadat City, Egypt.
Mohamed.Elshal@gebri.usc.edu.eg
Key Words: ConA lectin, Tamoxifen, MCF-7 cells, Antitumor
ABSTRACT
Proteins with legume lectin domains are known to possess a wide
range of biological functions. The antitumor effects of Concanavalin-A
(ConA) lectin and Tamoxifen (potent antagonist of estrogen and induces
apoptosis in MCF-7 cells) on human breast carcinoma cells were
investigated in vitro. Human breast carcinoma MCF-7 cells were
examined, cell viability, proliferation and cytotoxicity of MCF cells
treated with ConA and Tamoxifen using morphological analysis and
MTT cytotoxicity assay. The effects of ConA compared to Tamoxifen on
the expression of the transcription factor Erα and the expression of antiapoptosis
gene (Bcl2) in breast cancer MCF7 cell line were evaluated by
RT-PCR. The microscopic examination of cells indicated that ConA
induced significant cellular alterations typical of apoptosis cell-death in a
comparable manner as Tamoxifen. ConA showed also proliferation
inhibition activity, however it was lower than tamoxifen, as indicated by
MTT growth inhibition assay. The IC50 of ConA is 7.55 μM and of
Tamoxifen is 2.75 μM. The expression of Erα and Bcl2 proteins after
treatment with ConA were significantly decreased. In conclusion: ConA
induced significant apoptosis and inhibited the proliferation of breast
cancer cells that may be through mechanism involve reduction in the
expression of ERα and anti-apoptotic gene BCl-2. Finally, our results
indicate that ConA exerts anti-tumor actions against human breast
carcinoma MCF-7 cells in vitro and confer support for more research to
unravel the potentials of using concanavalin-A as complementary
treatment of ER+ breast cancer.
Egypt. J. of Appl. Sci., 35 (12) 2020 220-228
INTRODUCTION:
Breast cancer is a malignant tumor that starts in the cells of the
breast. A malignant tumor is a group of cancer cells that can grow into
surrounding tissues or spread to distant areas of the body. The disease occurs
almost entirely in women, but men can get it, too (Girish et al. 2014).
Transcription factors typically regulate gene expression by
binding cis-acting regulatory elements defined as enhancers and by
recruiting coactivators and RNA polymerase II (RNA Pol II) to target genes
(Ong and Corces, 2011; Lelli et al. 2012). Enhancers are segments of DNA
that are generally a few hundred base pairs in length and are typically
occupied by multiple transcription factors (Spitz and Furlong 2012). As for
breast cancer, MCF-7 cells represent a very important candidate as they are
used ubiquitously in research for estrogen receptor (ER)-positive breast
cancer cell experiments and many sub-clones, which have been established,
represent different classes of ER-positive tumors with varying nuclear
receptor expression levels (Sweeney et al. 2013).
Lectins can inhibit tumor genesis by binding to glycosylated proteins
on the membrane of cancer cells. It is well known that glycoconjugates play
important roles in many biological processes, including cancer, with
malignant cells usually presenting altered glycosylation patterns (Marques
et al. 2017). These changes in glycans allow preferential binding of lectin on
cancer cells to induce the above effects (Cavada et al. 2019). Tamoxifen is
a drug that has been in worldwide use for the treatment of estrogen receptor
(ER)-positive breast cancer for over 30 years; it has been used in both the
metastatic and adjuvant settings (Lazzeroni et al. 2012).
This study was aimed to measure cellular metabolic activity as an
indicator of cell viability, proliferation and cytotoxicity of MCF cells treated
with Concavalin-A (ConA) and compare its cytotoxic effects with the
standard breast cancer chemotherapy Tamoxifen (TAM) by MTT
cytotoxicity assay. Then, evaluation the effect of ConA lectin or Tamoxifen
drug on breast cancer MCF7 cell line by Real Time PCR on the transcription
factor protein ER-alpha and the anti-apoptotic BCl-2 gene expression.
MATERIALS AND METHODS
Chemicals
RPMI-1640, FBS, trypsin, penicillin, and streptomycin were
purchased from Gibco (Invitrogen, Grand Island, NY). 3-(4,5-Dimethyl
thiazol-2yl)-2,5-diphenyltetrazolium bromide (MTT), dimethyl sulfoxide
(DMSO), were purchased from Sigma-Aldrich (St. Louis, MO). Annexin VFITC
and PI double staining kit were purchased from BD (Waltham, MA).
Tamoxifen (Sigma, St. Louis, MO) was the standard drugs used as positive
control in this study.
221 Egypt. J. of Appl. Sci., 35 (12) 2020
Cell culture
Breast adenocarcinoma MCF-7 cells were cultured in RPMI1640
media containing 10% FBS, 100mg/mL streptomycin, 100 U/mL penicillin,
and 0.03% L-glutamine and were maintained at 37 °C with 5% CO2 in a
humidified atmosphere (Zheng et al. 2014).
MTT Cytotoxicity assay
The tetrazolium salt 3, (4.5-dimethyl-thiazol- 2-yl)-2, 5-diphenyl
tetrazolium bromide (MTT) cytotoxicity assay was used to evaluate
antiproliferative capacity of Lectin towards MCF-7 cell line. Briefly, cells
were seeded at 2×104 cell/well in 96-well tissue culture plates and allowed
to attach for 24 hr. Cells were then exposed to variable concentrations at 10,
0.39, 1.56, 6.25, 25 and 100 μM of lectin or Tamoxifen (as positive control)
dissolved in the RPMI medium for 24 hr. After incubation, plates were
centrifuged (500g, 5 min) and the supernatant was removed, followed by an
addition of MTT solution (0.5mg/mL in PBS) and incubation for 4 hr at
37◦C and 5% CO2. The medium was discarded, and the cells were then
lysed in 10% SDS/HCl 0.01N overnight. Absorbance was measured in a
microplate reader at 570 nm. The concentration that inhibits 50% of cell
proliferation (IC50) was determined from plots of cell viability (Faheina-
Martins et al. 2011).
Analysis of Apoptosis by Flow Cytometry Assay
Apoptosis detection was performed by FITC Annexin-V/PI kit
(Becton Dickenson, Franklin Lakes, NJ, USA) following the manufacture’s
protocol. Briefly, cells were harvested in single cell suspension. Cells were
incubated with Annexin V-FITC, USA before fixation since any cell
membrane disruption can cause nonspecific binding of Annexin V to PS on
the inner surface of the cell membrane). The cells were washed and fixed in
2% formaldehyde before analysis. The cytometer was set for appropriate
FSC vs. SSC gates to exclude debris and cell aggregates. Collect annexin V
fluorescence at FL-1 and Propidium iodide fluorescence at FL2.
Molecular gene expression analysis
Analysis of the expression of the anti-apoptosis BCL-2 as well as the
expression of the transcription factor ERα gene were done using Real Time
Polymerase Chain Reaction (RT-PCR) to identify the molecular effects of
con A lectin or tamoxifen on MCF 7 cells. mRNA isolation is carried out
using RNeasy extraction kit, up to 1x106 cells, depending on the cell line,
cells were disrupted in Buffer RLT. Ethanol is then was added to the cell’s
lysate, creating conditions that promote selective binding of RNA to the
RNeasy membrane. The sample was then applied to the RNeasy Mini spin
column. RNA was then eluted in RNase-free water. A specific primer used
for detection of Bcl2, and ERα genes, primers pairs were designed (table 1),
and acquired in lyophilized form (BioRad, USA).
Egypt. J. of Appl. Sci., 35 (12) 2020 222
Table 1: the sequences of the specific primers used in the project to
amplify regions of Bcl2, and ERα genes:
Gene Sequence (5’-3’)
Bcl2 Forward AAGCCGGCGACGACTTCT
Reverse GGTGCCGGTTCAGGTACTCA
ERα Forward AATTCTGACAATCGACGCCAG
Reverse GTGCTTCAACATTCTCCCTCCTC
GAPDH Forward GAAGGTGAAGGTCGGAGTCA
Reverse TTGAGGTCAATGAAGGGGTC
PCR amplification was performed in 25uL 2X SYBR Green RTPCR
reaction mix, 1.5uL of each primer (10uM), 10uL of RNA template
(1pg to 100ng total RNA), 11uL of Nuclease-free H2O and 1uL of
iScriptT reverse trancriptase for one- step RT-PCR (total volume 50uL).
The cycling conditions for detection of ERα and Bcl2 were done by
Rotorgene Q RT- PCR system, Germany.
RESULTS
Morphological changes
MCF-7 cells were the epithelial-like and grow in monolayers.
When grown in vitro, the cell line was capable of forming domes before
plating (75% cells). MCF7 cells were grown, propagated and proliferated
forming chains after plating (85% cells) for 24 h incubation. Figure 1
demonstrates the morphological changes of cells after treatment with
ConA or Tamoxifen drug, which indicated that either treatments resulted
in remarkable morphological changes typical of apoptosis and major
proliferation inhibition, however TAM showed more prilferation
inhibitory activity on cells than ConA.
Figure 1: Microscopic examination of MCF-7 treated with lectin (A) and
tamoxifen (B). Red arrows refer to apoptotic cancer cells.
Cytotoxic effect of ConA Lectin and Tamoxifen on MCF7 cells
Cells were incubated with different concentrations of ConA and
Tamoxifen (0.39, 1.56, 6.25, 25, 100 uM) as shown in Figure 2. The
MTT cytotoxicity results indicated that ConA has a less potent growth
223 Egypt. J. of Appl. Sci., 35 (12) 2020
inhibitory activity toward MCF-7 cells than Tamoxifen. The IC50 is the
concentration of an inhibitor where the response is reduced by half ConA
is 7 μM, and in Tamoxifen is 3 μM (figure 2).
Figure 2: Inhibitory rate and calculation of IC50 of ConA and Tamoxifen.
ConA IC50= 7 μM, TAM IC50= 3 μM. Data representative of mean
of three independent experiments.
Genes Expressions
ER alpha was down regulated that inhibited the growth MCF7
Cells treated with conA and Tamoxifen (figure 3A). The anti-apoptosis
gene BCl-2 expression was found decreased after the addition of ConA
and Tamoxifen drug (figure 3B).
Figure 3: Relative gene expression of ER alpha(A) and the anti-apoptosis gene
Bcl-2 (B). Data representative of mean of three independent
experiments.
Egypt. J. of Appl. Sci., 35 (12) 2020 224
DISCUSSION
Concanavalin A (ConA) is a long-studied representative legume
lectin that reportedly diversifies human cancer cell death by targeting
programmed cell death (PCD) (Tammy et al., 2015). Additionally, ConA
reportedly induces leukemic cell death and promoted apoptosis with
DNA fragmentation (Zheng et al. 2014). In Zheng et al. 2014 study,
ConA induced MCF-7 apoptosis cell death in a dose- and time-dependent
manner. The WST-1 assay demonstrated that after 24 h incubation with
18μg/mL ConA, the MCF-7 cell inhibitory rate reached nearly 50%,
while the ConA IC50 values detected by the CCK-8 assay were 15μg/mL.
In agreement with that study, our data revealed that MCF7 cells when
incubated with different concentrations of ConA and Tamoxifen as for 24
h, resulted in a more potent growth inhibitory activity toward MCF-7
cells than Tamoxifen alone as indicated by morphological alterations
typical of apoptosis, and growth inhibition activity more prevalent in
samples treated with tamoxifen than samples treated with ConA.
In addition, cell growth progression may be another mechanism
by which tamoxifen and ConA exert their anti-proliferative effects on
MCF-7 cell line. In the current study, MTT reduction assay showed a
significant inhibition of cell growth in samples treated with in samples
treated with TAM in comparison with that treated with ConA.
Additionally, results of the MTT assay indicated that the calculated IC50
of ConA was 7.55uM, and of Tamoxifen was 2.75uM. These results
indicated that TAM has a great cytotoxicity effect toward MCF-7 cells
than ConA. These results indicated that different mechanisms (apoptosis
induction) were induced by Tamoxifen and ConA.
Estrogen receptor-α (ERα) is a key transcription factor in breast
cancer that participates in a variety of different signaling pathways and
promotes the expression of the oncogenic protein Bcl-2 protein (Sabbah
et al. 1999). In addition, it was reported that down-regulation of ERa
accompanied with retardation of progression of the cell cycle, and
reduced Bcl-2 expression, frequently leading to apoptosis (Altucci et al.
1996). In agreement with these data, we found that the inhibition of
MCF7 cells growth was accompanied with downregulation of ERα
mRNA that treated with conA (0.73 fold), Tamoxifen (0.55 fold). In
addition, we found a significant decrease in the expression of Bcl-2 in
MCF-7 cells treated tamoxifen and that treated with ConA. These data
are in line with study by Mohamed et al. (2019) who assessed the
antitumor activity of Sal-B against breast cancer cells and compare it to
225 Egypt. J. of Appl. Sci., 35 (12) 2020
that of the chemotherapeutic drug cisplatin. The researchers found that
Sal-B significantly reduced the cell viability of MCF-7 cells in vitro in a
concentration-and time-dependent manner through a mechanism involves
reduction of the oncogenic anti-apoptotic gene Bcl2. In another study by
Luiz et al. (2018), MCF7 cells treated with Halilectin-3H3 at 100μg/ml
for 6 h showed an over-expression of CASP 3 and CASP 8. Remarkably,
after 24 h there was a decrease in the expression of the anti-apoptotic
gene BCL-2 but not in BAX and TP53. Thereby, emphasizing the role of
Bcl-2 in inducing MCF7 apoptosis.
In summary, the present study, demonstrated that the lectin ConA
was able to induce apoptosis in ER alpha-positive MCF-7 cell line in a
comparable fashion as the breast cancer-chemotherapy Tamoxifen and
that may be related to the downregulation of the transcription factor ERAlpha
and accompanied downregulation of the oncogenic anti-apoptosis
gene BCL-2. Finally, our results indicate that ConA exerts anti-tumor
actions against human breast carcinoma MCF-7 cells in vitro and confer
support for more research to unravel the potentials of using
concanavalin-A as complementary treatment of ER+ breast cancer.
REFERENCES
Altucci, L. ; R. Addeo ; L. Cicatiello ; S. Dauvois and M.G. Parker
(1996): 17beta-Estradiol induces cyclin D1 gene transcription,
p36D1-p34cdk4 complex activation and p105Rb
phosphorylation during mitogenic stimulation of G (1)-arrested
human breast cancer cells. Oncogene., 12: 2315–2324.
Cavada, B.S. ; V.R. Pinto-Junior ; V.J.S. Osterne and K.S. Nascimento
(2019): ConA-Like Lectins: High Similarity Proteins as Models to
Study Structure/Biological Activities Relationships. Int J Mol Sci.,
20(1): 30. doi: 10.3390/ijms20010030.
Faheina-Martins, G.V.; A.L. Silveira ; M.V. Ramos ; L.F. Marques-
Santos and D.A.M. Araujo (2011): Influence of Fetal Bovine
Serum on Cytotoxic and Genotoxic Effects of Lectins in MCF-7
Cells. J.Biochem Molecular Toxicology., 25(5) Doi 10:1002/Jbt.
Girish, Ch.; Vijayalakshmi, P.; Ramesh Mentham; Chandu Babu
Rao and Sreekanth Nama. (2014): International Journal of
Pharmacy and Biological Sciences. IJPBS |Volume 4| Issue
2|APR-JUN|.
Lazzeroni, M.; S.Davide; K.Barbara; M.Brandy; L.Oukseub; K.
Seema and D. Andrea (2012): Oral low dose and topical
tamoxifen for breast cancer prevention: modern approaches for
an old drug. Breast Cancer Research, 14:214.
Egypt. J. of Appl. Sci., 35 (12) 2020 226
Lelli, K.M.; M. Slattery and R.S. Mann (2012): Disentangling the
many layers of eukaryotic transcriptional regulation. Annu Rev
Genet.; 46:43–68.
Luiz G do Nascimento-Neto; Maria G.Cabral; Romulo F. Carneiro; Zelia
Silva; Francisco V.S. Arruda; Celso S. Nagano; Alexandra R.
Fernandes; Alexandre H. Sampaio; Edson H. Teixeira and Paula
A. Videira (2018): Halilectin-3, a Lectin from the Marine Sponge
Haliclona caerulea, Induces Apoptosis and Autophagy in Human
Breast Cancer MCF7 Cells Through Caspase-9 Pathway and LC3-II
Protein Expression. Anticancer Agents Med Chem; 18(4):521-528.
doi: 10.2174/1871520617666171114094847.
Marques, G.F.O.; V.J.S. Osterne ; L.M. Almeida ; M.V. Oliveira ;
L.A.C. Brizeno ; V.R. Pinto-Junior ; M.Q. Santiago ; A.H.B.
Neco ; M.R.L. Mota and L.A.G. Souza (2017): Contribution of
the carbohydrate-binding ability of Vatairea guianensis lectin to
induce edematogenic activity. Biochimie; 140:58–65. doi:
10.1016/j.biochi.2017.06.008.
Mohamed, A.K. ; A. Rafik; A. Abdulmohsin; A. Mohamed and A.
Ahmed (2019): Salvianolic Acid B Slows the Progression of
Breast Cancer Cell Growth via Enhancement of Apoptosis and
Reduction of Oxidative Stress, Inflammation, and Angiogenesis
Int J Mol Sci., 12;20(22):5653. doi: 10.3390/ijms20225653.
Ong, C.T and V.G. Corces (2011): Enhancer functions: new insights
into the regulation of tissue-specific gene expression. Nat Rev
Genet.; 12:283–293.
Sabbah, M.; D. Courilleau ; J. Mester and G. Redeuilh (1999):
Estrogen induction of thecyclin D1 promoter: involvement of a
cAMP response-like element. Proceedings of the National
Academy of Sciences., 96: 11217–11222.
Spitz, F. and E.E. Furlong (2012): Transcription factors: from enhancer
binding to developmental control. Nat Rev Genet. 13:613–626.
Sweeney, E.E.; R.E. Mcdaniel ; P.Y. Maximov ; P. Fan and V. Craig,
(2013): Models and Mechanisms of Acquired Antihormone
Resistance in Breast Cancer: Significant Clinical Progress
despite Limitations. Horm Mol Biol Clin Investig., 9: 143-163.
Tammy, Y.; D. Xiuli ; Charlene Cheuk ; N. Wing and N Tzi
Bun (2015): Lectins with potential for anti-cancer therapy.
Molecules 26; 20(3):3791-810. doi:
10.3390/molecules20033791.
Zheng, S.H.I.; C.H.E.N. Jie ; L.I. Chun-yang ; A.N. Na ; W.A.N.G. Zi-jie ;
Y.A.N.G. Shu-lin ; H.U.A.N.G. Kai-feng and B.A.O. Jin-ku (2014):
Antitumor effects of concanavalin A and Sophora favescens lectin in
vitro and in vivo. Acta Pharmacologica Sinica; 35: 248–256.
227 Egypt. J. of Appl. Sci., 35 (12) 2020
د ا رسات جزيئية حيويه لعامل نسخ مستقبل الاستروجين في مرض سرطان الثدي
المعالج باليکتين
محمد الشال ١، إب ا رهيم السيد ٢، وائل عبد المجيد ٣، محمود جاد الله ٤، نورهان عيد ١
١-قسم البيولوجيا الجزيئية، معهد الهندسة الو ا رثية والتکنولوجيا الحيوية، جامعة مدينة السادات.
٢-قسم الکيمياء، کمية العموم، جامعة کفر الشيخ.
٣-قسم الو ا رثة، کمية الز ا رعة، جامعة بني سويف.
٤-قسم المشخصات الجزيئية، معهد الهندسة الو ا رثية والتکنولوجيا الحيوية، جامعة مدينة السادات.
المقدمة
يعتبر سرطان الثدي من الأو ا رم الخبيثة ويبدأ في خلايا الثدي. والورم الخبيث هو مجموعة من
الخلايا السرطانية التي يمکن أن تنمو إلى أنسجة محيطة أو تنتشر إلى مناطق بعيدة من الجسم. ويحدث
المرض بالکامل تقريباً لدى النساء ولکن قد يحدث أيضا لدي الرجال. ومن المعروف ان البروتينات التي
تحتوي عمي ليکتين تؤثر في العديد من الوظائف الحيوية. ويمکن لميکتين ان يمنع تکون الأو ا رم عن
طريق ربط البروتينات الزلالية عمى غشاء الاغشية السرطانية.
الهدف من الد ا رسة
تهدف الد ا رسة الي قياس نشاط الايض الخموي کمؤشر عمى قدرة الخلايا عمى البقاء والانتشار
ومدى سمية الخلايا التي تعالج بالکونکافالين مقارنة بمدى سمية الخلايا مع العلاج الکيميائي التقميدي
لسرطان الثدي بعقار التاموکسيفين.
المواد والطرق المستخدمة
تمت الد ا رسة من خلال تقنيات ز ا رعة الخلايا بواسطة کيماويات خاصة وتم تقييم مدى سمية
الخلايا عن طريق تعريض الخلايا لترکي ا زت مختمفة من مادتي الميکتين وعقار التاموکسيفين ومتابعة مدى
نمو الخلايا. وتم تقييم مدي استماتة الخلايا بتقنية قياس التدفق الخموي. وقياس التعبير الجيني الجزيئي
بواسطة تفاعل البممرة المتسمسل.
النتائج
أظهرت الد ا رسة ان استخدام الکونکافالين أدى الي موت واضح لمخلايا السرطانية کما أدى أيضا
الي تثبيط تکاثر وت ا زيد الخلايا السرطانية من خلال تقميص التعبير الجيني الخاص بسرطان الثدي.
وأخي ا ر فإن الد ا رسة أوضحت ان استخدام الکونکافالين له تأثير مضاد لأو ا رم سرطان الثدي من خلال
ز ا رعتها خارج الجسم مما يفتح المجال من خلال د ا رسة استخدام الکونکافالين کمساعد علاجي في علاج
سرطان الثدي.
Egypt. J. of Appl. Sci., 35 (12) 2020 228
View on SCiNiTO
