DIETARY OMEGA 3 NANOPARTICLES SUPPLEMENT IMPROVE GROWTH OF NILE TILAPIA, (OREOCHROMIS NILOTICUS)

CONCLUSIONS:
In conclusion, these findings of the present study indicate that
feeding Nile tilapia with a diet containing omega 3- chitosan
nanoparticles (0.25g, 0. 5g, and 1g/kg), on a period of 90 days might be
adequate to improve fish growth, immune parameters, antioxidant status .
In addition, Nano diet improved growth performance and faster growth
rate through nutritional manipulation in Nile tilapia fish via improving
oxidative stress and improves immune function. Hence, the responses of
fish are likely to change depending on different doses. Therefore, further
investigations are encouraged in order to evaluate and understand the
effects of different levels of omega 3- chitosan nanoparticles on various
Nile tilapia fingerlings, as well as their reactions to different fish
pathogens. Omega 3 is a very important element for counteracting stress
responses in fish and livestock and showed significant efficiency at
nanoscale level. Animal and fishery researchers can initiate Nanochitosan
work because of its more bioavailability, bio efficacy, and low
toxicity. Industry can select this multipurpose feed additive against
diseases like cancer, gastro enteritis, etc. or as a common antidote and
immunomodulatory molecule against any single or composite stressors.
These findings suggest that omega 3- chitosan nanoparticles possess a
potential effect in Promoting growth in Nile tilapia fish via improving
oxidative stress and improves immune function. Future investigations
regarding omega 3- chitosan nanoparticles acts as an immunomodulatory
when used as a dietary supplement. omega 3- chitosan nanoparticles may
influence fish intestinal health by stimulating immunological parameters
and affecting the diversity of the microflora in the intestine.

DIETARY OMEGA 3 NANOPARTICLES
SUPPLEMENT IMPROVE GROWTH OF NILE
TILAPIA, (OREOCHROMIS NILOTICUS)
Hemmat M. Eissa ; Safaa I. Khater ; Doaa I. Mohamed
and Medhat M. Fawzey
Faculty of Vet. Medicine, Zagazig University, Egypt.
Running title: Nanoparticles improve growth and immunity of Nile
Tilapia.
Key Words: Omega 3, chitosan nanoparticles, Nile Tilapia, growth
performance.
ABSTRACT:
This work was planned to investigate the potential effect of omega
3 chitosan nanoparticles in Nile tilapia fingerlings. Two hundred forty
Nile tilapia were used into f
our groups; control diet without omega 3- chitosan nanoparticles,
omega 3- chitosan nanoparticles (0.25g/kg), omega 3- chitosan
nanoparticles (0.5g/kg) and omega 3- chitosan nanoparticles (1g/kg) for
12 weeks. Our data obtained showed that, significant differences were
found in growth parameters, including final body weight (g), body gain
(g), body gain (%), protein efficiency ratio, specific growth rate (%) and
feed conversion ratio. In addition, our data presented showed that total
cholesterol, triacylglycerdes (TAG), high-density lipoprotein (HDLc),
low-density lipoprotein(LDLc), total protein (TP), albumin, alanine
aminotransferase (ALT) and aspartate aminotransferase (AST) were
significantly affected by adding omega 3-chitosan nanoparticles in diet
and showed high significant differences (p < 0.05). However, showed no
significant differences (p > 0.05) on globulin (GLO) but were significant
differences (p < 0.05) on interleukin-1 (IL1), interleukin-6 (IL6), and fish
tumor necrosis factor (TNF-α). In molecular expression, omega-chitosan
NPs 0.5 and 1 g/kg were the most significant treated one on interleukin-1
beta (IL1- beta) but control diet in molecular expression of toll like
receptors factores 2 (TLR2) was the most significant treated one.
INTRODUCTION:
The fisheries and livestock sectors were an important agriculture
subsidiary. They were recently drawing wide attention thanks to their
accelerating growth and because of high market demand. In addition,
fishery has becoming popular. Fish have vital food sources rich in
simple, digestible animal proteins and beneficial lipids. Fish products
have essential to one billion individuals for protein security and
particularly vital for juvenile and pregnant women as well [1]. In
addition, the development of Nano technological formulations for
application in aquaculture has been a major focus of research conducted
Egypt. J. of Appl. Sci., 35 (12) 2020 242-260
in this industrial domain. They are suitable for multiple applications,
including growth performance, administration of vaccines, antibiotics,
other pharmaceuticals and nutraceuticals is a key feature of these systems
[2]. Currently much of the tilapia production takes place in intensive
practices. There have been problems, especially in early stages, as
disease outbreaks [3]. However, the concept of functional foods has used
in the food industry for production animals.in addition to meeting the
nutritional requirements; they also need to improve the health of farmed
fish [4, 5]. The functional feed additives promoted growth, immune
response; induced the physiological functions and health performance of
the fishes better than the normal feed additives. Moreover, functional
feed additives have been included phytogenic compounds, mycotoxin
binders, organic acids, immune – stimulants, yeast products, probiotics,
prebiotics, enzymes [6]. Also, Chitosan has been used as natural
polymers to coat different nanoparticles (NP) for their unique and
outstanding bio degrable, biocompatible, and muco adhesive properties.
Permeation promoted ability for the absorption of hydrophilic molecules
such as insulin as well. Allowing chitosan to transiently open tight
junctions among the intestinal cells to go through Para cellular pathway
of absorption when administered orally. In addition, through intranasal
route of administration, chitosan can improve residence time of the used
nanoparticles (NP) via its bio adhesive characteristics. It also causes
chitosan nanoparticles (NP) to adhere to the mucosa and increase drug
bioavailability to enhance its absorption [7]. Apart from the various
biological functions, has been found that chitosan is used as a food
additive. Chitosan with high molecular weight is more effective as a food
additive when compared to low molecular weight chitosan as well [8].
Omega-3 fatty acids represent a family of polyunsaturated fatty acids. In
addition, they are called essential fatty acids. They are very important for
the body [9]. It has been stated with regard to anti-inflammatory
properties, omega-3 in the form of eicosapentaenoic acid (EPA) and
docosahexaenoic acid (DHA) has been received higher prominence [10,
11]. It has been regarded that anti-inflammatory effects of omega-3 poly
unsaturated fatty acids (PUFA) may decrease pro inflammatory cytokines
and oxidative stress in adipocytes, leading to a lower rate of ectopic lipid
accumulation in the liver [12].
The reason for conducting this study was the massive availability,
use of nanoparticles element such as omega 3 and chitosan as growth
promotors in Nile Tilapia. This experiment was designed to determine
the possible application of omega 3- chitosan nanoparticles as a potential
dietary supplement for Nile Tilapia through determination of: growth
performance parameters , total protein (TP), plasma albumin, plasma
globulin , alanine transaminase (ALT) , aspartate transaminase (AST)
243 Egypt. J. of Appl. Sci., 35 (12) 2020
,total cholesterol , triacylglycerdes (TAG) , high-density lipoprotein
(HDLc) , low-density lipoprotein (LDLc), fish interleukin-1 (IL1), fish
interleukin-6 (IL6) , fish tumor necrosis factor α (TNF-α) and molecular
studying of toll like receptors 2 (TLR2 ) and interleukin 1 beta (IL1-
beta) by using real time polymerase chain reaction .
MATERIAL AND METHODS:
Preparation of Omega Chitosan Nanoparticles
The samples were irradiation with Co60 (Ge4000A Cell) Indian
irradiation facility gamma rays at a dose rate ranged (1.144 KGy/h). The
irradiation facility was constructed by the National Center for Radiation
Research and Technology, Atomic Energy Authority of Egypt. The
infrared spectra were performed by using FTIR spectrophotometer,
Mattson 100 UniCam, England, over the range 400–4000 cm-1. A dry
constant weight from each composite was ground with 20μg of KBr and
then pressed to form transparent disks. The samples for IR analysis were
first dried in a vacuum oven at 80oC for 2 hr.
Fish and experimental design:
They were carried out at fish research unit (F.R.U), and
Biochemistry Department, Faculty of Veterinary Medicine, Zagazig
University. Nile tilapia with average initial weight of (18.42 g) were
purchased from a local fish hatchery (Central laboratory for aquaculture
research, Abbassa, Abu-Hammad, Sharkia, Egypt). The fish were dived
into equal 4 triplicate of the fish groups (each replicate group contained
20 fish) and each replicate of the fish groups was stocked in its
corresponding glass aquarium for two weeks to be acclimatized before
the start of the experiment. The fish were fed is nitrogenous (37 %CP),
isochoric (DE, 2900Kcal) diet contained (omega 3- chitosan
nanoparticles) by three levels (0.25g, 0. 5g, and 1g/kg), the diet of Nile
tilapia [13]. The fish in the experiment were located in 12 rectangular
glass aquaria (150x 40x 30 cm) filled with dechlorinated tap water which
continuously aerated by a small air compressor which were used to
represent 4 experimental treatments (3 replicates per treatment) and each
aquarium was stocked with 20 fish .The institutional fish care and use
committee of the Faculty of Veterinary Medicine; Zagazig University
approved our study (ZU-IACUC/2/F/53/2020). All fish were adapted for
a small period of two week prior to start the beginning of the study. Nile
tilapia were used into four triplicate groups; control diet, omega 3-
chitosan nanoparticles 0.25(g/kg), omega 3- chitosan nanoparticles
(0.5g/kg) and omega 3- chitosan nanoparticles (1g/kg).All groups were
given respective orally treatment via diet which was performed in glass
aquaria for duration of 12 weeks. Fishmeal, soybeans meal, poultry-by-
Egypt. J. of Appl. Sci., 35 (12) 2020 244
products meal, yellow corn, corn gluten, wheat bran and vegetable oils
were used as the main feeds ingredients in diets formulation besides
lysine, methionine, calcium dibasic phosphate and vitamins and minerals
mixture were added. Isonitrogenous (37 %CP), isochoric (DE, 2900Kcal)
diets were formulated according to [14] as with addition of omega 3
loaded chitosan nanoparticle as mash diet and mixed with ingredient .
Water characteristics
Dissolved oxygen (D.O):- It was 5.4 ± 0.1 mg / L. PH: - It was 7.5
± 0.07. Water temperature: - The average water temperature during
experiment was 24°c ± 2 °c (adapted by using water heater). Nitrite
(NO2): - The nitrite level in fishponds was 0.024± 0.02 mg / L. 5- Nitrate
(NO3):- It was 7± 0.2 mg /L. Ammonium (NH4): The ammonium level
in fishponds was 0.4± 0.2 mg / L. Total hardness: - It was 160.25 ±
0.07mg / L. Phosphate (PO4):- It was 0.25± 0.01 mg / L.
Sampling
Under hygienic condition blood sample were collected
once without using anesthesia from a random sample of fish/group at the
end the experiment. Blood samples were collected from caudal vein were
collected from a random sample of fish ∕group and pooling to the blood
sample from different fish in the same sample [15]. Immediately after
scarifying, take liver, intestine and muscle. Every sample was divided to
2 parts; one was wrapped in aluminum foil and put immediately in liquid
nitrogen container to make snap freezing for molecular investigation.
Second part kept at -20 oC to be homogenized for antioxidants
measurements.
Growth performance determination:
According to Merrifield et al [16] were calculated weight gain (g
/fish), weight gain (WG, %) , specific growth rate % , protein efficiency
ratio and feed conversion ratio (FCR).
Biochemical determinations:
Determination of plasma total protein (TP) according to Yatzidis et
al [17]. Plasma albumin, plasma globulin outlined by Doumas et al [18].
Plasma alanine aminotransferase (ALT) reported by Breuer [19]. Plasma
aspartate aminotransferase (AST) reported by Sherwin et al [20].
Determination of total cholesterol described by Naito and Kaplan [21].
Triacylglycerdes (TAG) was assayed according to Burtis et al [22]. highdensity
lipoprotein (HDLc) and low-density lipoprotein (LDLc)
according to Naito and Kaplan [21]. Determination of Interleukin-1 (IL-
1) was assayed using Kit (Cat.No: MBS042749). This Quantitative
Sandwich ELISA kit was for lab reagent/research use only, not for drug,
household, therapeutic or diagnostic applications! This kit is intended to
245 Egypt. J. of Appl. Sci., 35 (12) 2020
be used to determine the level of Interleukin-1 (IL-1) (hereafter termed
“analyte”) in undiluted original fish serum, plasma or tissue homogenates
samples. Determination of fish Interleukin-6 (IL-6) was assayed using
Elisa Kit (Catalog Number. MBS702353). This assay employs the
competitive inhibition enzyme immunoassay technique. The microtiter
plate provided in this kit has been pre-coated with an antibody specific to
IL-6. Determination of fish tumor necrosis factor α (TNF-α) was assayed
using Kit (Cat.No: MBS281612). This assay employs a two-site
sandwich ELISA Kit to quantitate fish tumor necrosis factor α (TNF-α)
in Fish serum, plasma. An antibody specific for fish tumor necrosis factor
α (TNF-α) were pre-coated onto a microplate.
Molecular determinations:
Determination of the levels of expression of interleukin-1 beta
(IL1- beta) and toll like receptors 2 (TLR2), using Real Time-PCR.
Using Pure Link® RNA Mini Kit obtained from Ambion by life
technologies by Thermo Scientific, Catalog numbers: 12183018A and
using the manufacture instructions. The formation of cDNA was done by
using High Capacity cDNA Reverse Transcription Kit obtained from
Thermo Scientific, code 4374966.Amplification was done using SYBR
Green qPCR Master Mix (2X) kit obtained from Thermo scientific,
catalog #K0251. The amount of target gene expression levels was
estimated using the formula of 2-ΔΔct Livak and Schmittgen, [23] and
using internal control GAPDH. The primer sequences were designed as
fellow: Toll-Like Receptors 2 (TLR2) [24] primer sequence (5′-3′), FCAGCCATTGACTCTCTGCCT`
\ R-CACCAGTGGCATGACCTTCA
and interleukin-1 beta (IL-1β) [25] primer sequence (5′-3′), FTGCTGAGCACAGAATTCCAG
\ RGCTGTGGAGAAGAACCAAGC.
Statistical analysis:
The results were done using mean and standard error (Mean ±
SEM).ANOVA test has been done to test the significant changes among
different groups. Duncan multiple range test was considered as a post hoc
test. The statistical analysis was done using IBM SPSS version 25.
RESULTS
Impact of omega 3- chitosan nanoparticles on Growth performance:
Our results showed that in table (1) fish groups fed on diet contained
omega 3 -chitosan nanoparticles 1 g/kg revealed significant increase (P
<0.05) in final body weight (g), body gain (g), body gain (%) , specific
growth rate (%) , feed conversion ratio and protein efficiency ratio when
compared with omega 3- chitosan nanoparticles 0.5 g/kg but there were no
Egypt. J. of Appl. Sci., 35 (12) 2020 246
significance difference (P >0.05) between fish groups feed on diet
contained control diet and omega 3- chitosan nanoparticles 0.25 g/kg.
Table (1): Impact of Omega – Chitosan Nanoparticles on Growth
performance:
Treatment
Control
omega 3 –
Chitosan
Nanoparticles
0.25 g/kg
omega 3 – Chitosan
Nanoparticles 0.5
g/kg
omega 3 –
Chitosan
Nanoparticles 1
g/kg
Initial body weight (g) 24.65 ±0.35 24.53 ±0.20 25.00 ±0.33 24.15±0.17
Final body weight (g) 64.54 ±1.00c 64.00±0.40 c 68.81 ±0.95 b 74.29 ±0.95 a
Body gain (g) 39.89 ±0.73 c 39.47 ±0.60 c 43.80 ±0.63 b 50.14 ±0.99 a
Body gain (%) 161.83 ±2.00 c 160.95 ±3.80 c 175.22 ±0.60 b 207.70±4.80 a
Specific growth rate (%) 1.15 ±0.01 c 1.14 ±0.01 c 1.21 ±0.01 b 1.34 ±0.02a
Feed conversion ratio 2.00±0.03c 1.98±0.01c 1.91±0.04b 1.74±0.02a
Protein efficiency ratio 1.53±0.01c 1.55±0.01c 1.64±0.04b 1.79±0.01a
Means of variables having different superscripts in the same raw are significantly different.
Impact of omega 3- chitosan nanoparticles on total cholesterol,
triacylglycerdes (TAG), high-density lipoprotein (HDLc) and lowdensity
lipoprotein LDLc:
Data presented in table (2) showed that fish groups fed on dietcontained
omega 3- chitosan nanoparticles (1 g /kg) in total cholesterol
revealed significant increase (P <0.05) when compared with control diet
while fish groups fed on diet-contained omega 3- chitosan nanoparticles
(0.5, 1 g /kg) in triacylglycerdes (TAG) revealed significant increase (P
<0.05) when compared with control diet but fish groups fed on dietcontained
omega 3- chitosan nanoparticles (0.5, 1 g /kg) in high-density
lipoprotein (HDLc) and low-density lipoprotein LDLc revealed
significant decrease (P <0.05) when compared with control diet.
Table (2): Impact of omega – Chitosan Nanoparticles on total
cholesterol, triacylglycerdes (TAG), high-density
lipoprotein (HDLc) and low-density lipoprotein LDLc:
Treatment Control
Omega- Chitosan
Nanoparticles
0.25 g /kg
Omega - Chitosan
Nanoparticles
0.5 g /kg
Omega -
Chitosan
Nanoparticles 1
g /kg
Total Cholesterol 150.33a 146.83a 140.90ab 138.20b
Triacylglycerdes
(TAG)
209.66a 184.96b 89.00c 86.06c
High-density
lipoprotein(HDLc)
33.60c 37.66bc 43.63a 43.60a
low-density
lipoprotein(LDLc)
74.80abc 72.17c 79.46a 77.38ab
Means of variables having different superscripts in the same raw are significantly different.
247 Egypt. J. of Appl. Sci., 35 (12) 2020
Impact of omega 3- chitosan nanoparticles on total protein (TP),
albumin, globulin (GLO), alanine aminotransferase (ALT) and
aspartate aminotransferase (AST):
Our obtained data in table (3) showed that fish groups fed on dietcontained
omega 3- chitosan nanoparticles (0.5, 1 g /kg) in total protein
(TP), albumin revealed significant increase (P <0.05) when compared
with control diet while no significance difference (P >0.05) among differ
experimental groups fed on diets contained different levels of omega 3-
chitosan nanoparticles in globulin but fish groups fed on diet-contained
omega 3- chitosan nanoparticles (0.5, 1 g /kg) in alanine
aminotransferase (ALT) and aspartate aminotransferase (AST) revealed
significant decrease (P <0.05) when compared with control diet.
Table (3): Impact of Omega – Chitosan Nanoparticles on total
protein (TP), albumin, globulin (GLO), alanine
aminotransferase (ALT) and aspartate aminotransferase
(AST):
Treatment
Control
Omega- Chitosan
Nanoparticles
0.25 g /kg
Omega - Chitosan
Nanoparticles
0.5 g /kg
Omega - Chitosan
Nanoparticles
1 g /kg
Total protein (TP) 5.23d 5.75b 5.80b 6.15a
albumin 2.14c 2.83b 3.45a 3.40a
Globulin (GLO) 3.19 2.83 2.39 2.70
Alanine
aminotransferase
(ALT)
22.10ab 21.97ab 20.50bc 19.63c
Aspartate
aminotransferase
(AST)
43.33ab 43.66ab 41.33abc 38.43c
Means of variables having different superscripts in the same raw are significantly different.
Impact of omega 3- chitosan nanoparticles on interleukin-1 (IL1),
interleukin-6 (IL6) and fish tumor necrosis factor (TNF-α):
Our obtained data in table (4) showed that fish groups fed on diet
contained omega 3- chitosan nanoparticles (0.5, 1 g /kg) in interleukin-
1(IL1), interleukin-6 (IL6) and fish tumor necrosis factor (TNF-α)
revealed significant increase (P <0.05) when compared with control diet.
Egypt. J. of Appl. Sci., 35 (12) 2020 248
Table (4): Impact of omega – Chitosan Nanoparticles on interleukin-
1 (IL1), interleukin-6 (IL6) and fish tumor necrosis
Factor (TNF-α):
Treatment
Control
Omega- Chitosan
Nanoparticles 0.25
g /kg
Omega - Chitosan
Nanoparticles 0.5 g
/kg
Omega -
Chitosan
Nanoparticles 1
g /kg
interleukin-1 (IL1) 3.72c 3.82c 4.20b 4.21b
interleukin-6 (IL6) 23.40b 24.56a 24.86a 24.90a
fish tumor necrosis
Factor (TNF-α)
16.13c 19.58b 21.35a 21.27a
Means of variables having different superscripts in the same raw are significantly different.
Impact of omega 3- chitosan nanoparticles on Interleukin-1 beta (IL1-
beta) and Toll-Like Receptors 2 (TLR2) in Nile tilapia by using real
time PCR:
Data presented showed that in table (5) fish groups fed on diets
contained omega 3- chitosan nanoparticles 0.5 and 1 g/kg revealed up
regulated expression of interleukin-1beta (IL-1β) (P < 0.05) followed by
group fed on diet contained omega 3- chitosan nanoparticles 0.25 g/kg
when compared with group fed on control diet. while groups fed on diets
contained omega 3- chitosan nanoparticles 0.25 g/kg revealed down
regulated expression level of toll-like receptors 2 (TLR2) (P < 0.05)
followed by group fed on diet contained omega 3- chitosan nanoparticles
0.5 g/kg then group fed on omega 3- chitosan nanoparticles 1 g/kg when
compared with group fed on control diet.
Table (5): Impact of omega – Chitosan Nanoparticles on interleukin-
1 beta (IL1- beta) and toll like receptors factores 2
(TLR2) in Nile tilapia by using real time PCR:
Treatment interleukin-1 beta (IL1- beta)
toll like receptors factores 2
(TLR2)
Control 1.000c ± 0.07 1.000 a ± 0.08
Omega- Chitosan
Nanoparticles 0.25 g/kg
1.13b ± 0.03 0.547b ± 0.16
Omega- Chitosan
Nanoparticles 0.5 g/kg
1.38a ± 0.07 0.500bc ± 0.25
Omega- Chitosan
Nanoparticles 1 g/kg
1.363a ± 0.15 0.427c ± 0.07
Means of variables having different superscripts in the same raw are significantly different.
DISCUSSION:
This study was designed to investigate the effects of adding omega
3 loaded chitosan nanoparticles in the diet of Nile tilapia and its effect on
249 Egypt. J. of Appl. Sci., 35 (12) 2020
growth performance, body composition, some immunological and
biochemical parameters and their economic efficiency.
The use of functional feed additives in aquaculture industry have
dual benefit of improved fish growth performance also it have posted
immune response of cultured fish .Moreover , the development of Nano
technological formulations for application in aquaculture has a major
focus of research conducted in this industrial domain. They were suitable
for multiple applications; including growth performance, administration
of vaccines, antibiotics, other pharmaceuticals in addition, nutraceuticals
is a key feature of these systems Rather et al [26]. Among this respective
feed additive were omega 3 and chitosan. It has been found application of
this Nano formulation will enhance fish growth also promote immune
statue. Dawood and Koshio , Ringø et al [27,28 ] said that these feed
additives has help increase immune status, feed efficiency, and growth
performance of fish and shellfish.
I) Using of Omega 3 Chitosan Nano particle as feed additive:
In this study, we have been investigated the effect of a nanoparticle
on growth performance mainly, which was produced, from two known
immune stimulants, namely Omega 3 and Chitosan. Through our
experiment, we observed that Omega 3-loaded chitosan nanoparticles
have stimulatory effect on growth performance, body composition, and
some immunological parameters, molecular studies, antioxidant status,
lipid profile and the anti-inflammatory effect in Nile tilapia.
It has been showed that Microencapsulation could be applied to
encapsulate natural compounds such as essential oils as omega 3 fatty
acid and plant extracts [29]. In aquaculture, found that many of oral
delivery systems of bioactive materials meet three main barriers while
passing through the gastrointestinal tract involving the enzymes,
immunological cells and the physical barrier of the epithelial cells [33].
Therefore, the encapsulation of bioactive compounds and functional
foods has a promising way to overcome these problems. Moreover,
chitosan can be acted as an encapsulating agent because of its
characteristics, such as non-toxicity, biocompatibility, mucus
adhesiveness also biodegradability characteristics [31].
II) Growth performance finding:
In our study, our presented data showed that fish groups fed on diet
contained omega 3 -chitosan NPs 1 g/kg showed significant increase in
final body weight (g), body gain (g), body gain (%), specific growth rate
(%), feed conversion ratio and protein efficiency ratio. There was an
Egypt. J. of Appl. Sci., 35 (12) 2020 250
increase in growth performance when there is an increase omega 3-
chitosan nanoparticles in diet. The higher condition factor showed that
the fish were gaining more mass relative to their length, which was
positive for the aquaculture industry as the fillets will be more robust per
fish in agreement with following findings.
Tilapia growth rate increased during the 90-day period and omega
3- chitosan nanoparticles 0.5 and 1 mg /kg revealed the most significant
in specific growth rate (%) and feed intake (g).
In agreement of our result, used omega 3- fatty acid (n-3 FA)
sources were either fishmeal or fish oil (FO), linseed or linseed oil (LO).
In addition, the use of fishmeal included at greater than 5% has been
reported to affect the performance parameters of broilers e.g. body
weight and feed conversion ratio (FCR) that resulted in reduced growth
rate causing subsequent economic losses for the producer Scaife et al
[32]. Previous studies have also indicated that feeding juvenile Nile
tilapia fish oil FO rich on omega 3- chitosan nanoparticles for 90 days
Justi et al [33] and at different levels (from 0.25g\kg to1g\kg)
Visentainer et al [34] stated satisfactory incorporation results for n‐ 3
fatty acids into muscle tissue. However, those shorter studies were been
conducted with juvenile Nile tilapias. Omega-3 UN saturated fatty acids
(UFAs) has important nutritional factors. They modulate immune
functions. Moreover, has a great importance for nervous system
development and for lowering blood platelet aggregation and the
incidence of thrombosis, hypertension, and atherosclerosis, and have
anti-tumor, anti-inflammatory, growth performance and cardio protective
effects Ahmad et al [35]. It has been proved that chitosan has more
additional biological properties. It works as an immune adjuvant and a
bacteriostatic agent Abu-Elala et al; Sun et al and Wang et al [36, 37,
and 38].
III) Effect of omega 3- chitosan nanoparticles on Immunity and
Biochemical parameters:
Our results documented that total cholesterol, triacylglycerdes
(TAG), high-density lipoprotein (HDLc), low-density lipoprotein
(LDLc), total protein (TP), albumin, alanine aminotransferase (ALT)
and aspartate aminotransferase (AST) were significantly affected and
showed high significant differences (p < 0.05). However, showed no
significant differences on globulin (GLO), interleukin-1 (IL1),
interleukin-6 (IL6), and fish tumor necrosis factor (TNF-α). In molecular
expression, omega 3- chitosan nanoparticles 0.5 and 1 g/kg were the most
251 Egypt. J. of Appl. Sci., 35 (12) 2020
significant treated one on interleukin-1 beta (IL1- beta) but control diet in
molecular expression of toll like receptors factores 2 (TLR2)was the
most significant treated one.
Additionally, oxidative stress, immunological and hematological
variables were essential blood parameters. It has been found they are
essential for monitoring the conditions of fish breeding Cecchini et al,
Fazio et al [39 , 43 ]. Also these blood parameters were been used to
estimate the effects of feed additives on fish as mentioned by Acar et al ,
Yilmaz [ 41 , 42]. Omega-3 fatty acids were been regarded to be cardio
protective Lemaitre et al; Hansen and Harris [43 , 44 ] and Anil [ 45]
showed a positive effect on both the blood lipid profile promote immune
statue in Nile Tilapia . Thus, Burk et al; Kumar et al [ 46 , 47] , have
been reported that an increased amount of these proteins will present a
more protective role and in turn promotes the immunity status of fish
.Therefore, several studies have shown the synergism between the use of
essential oils encapsulated in biodegradable nanoparticles according to
Chifiriuc et al; Pavela et al [48 , 49 ]. Moreover , several studies have
been shown the synergism between the use of essential oils encapsulated
in biodegradable nanoparticles according to Chifiriuc et al ; Pavela et al
[48 , 49 ]. In contrast with our results, has been found that using poly un
saturated fatty acids (PUFAs) in poultry diets significantly have reduced
the cholesterol and total lipid content in the blood. Therefore, several
studies have been conducted to minimize the harmful effects of
triglycerides and total cholesterol in poultry products Konieczka et al
[53]. In our study, high significant differences in interleukin-1 beta (IL1-
beta) in molecular expression level of omega 3 chitosan nanoparticles but
significantly lower in molecular expression level of toll like receptors
factores 2 (TLR2)with increase concentration of omega 3 chitosan
nanoparticles. Nanoparticles are able to exhibit a high rate of uptake in
the gastrointestinal tract even though the extent of absorption depends on
the nature of the particles employed, their surface charge, their colloidal
stability, the dose given and the species of animal [51]. Moreover,
changing chitosan to nanoparticles could be result in positive effects on
absorption surface area. In addition, increased absorption surface can be
enhance intestinal efficiency in digestion, absorption and consequently
feed conversion ratio and growth performance [16]. [52] has been
observed more intraepithelial lymphocytes in tilapia intestine after
feeding Lactobacillus rhamnosus GC-supplemented diet for 30 days. In
fact, teleost fish gut associated lymphoid tissue (GALT) lack the
Egypt. J. of Appl. Sci., 35 (12) 2020 252
organized Peyer Patches and mesenteric lymph nodes present in the
mammals GALT [53]. Intraepithelial mononuclear leukocytes, a
component of the gut associated lymphoid tissue, plays a major role in
mucosal defense mechanisms against intraluminal foreign antigens [54].
In previous study [55] due to the special characters of chitosan
nanoparticles, more efficient have been uptake by phagocytic cells
induced stronger systemic and mucosal immune responses in comparison
with chitosan. More studies are warranted to evaluate the effects of Nano
chitosan/Omega 3 fatty acid composites on immune system but this
preliminary study can show the potential of these additives on mucosal
immunity of fish intestine.
CONCLUSIONS:
In conclusion, these findings of the present study indicate that
feeding Nile tilapia with a diet containing omega 3- chitosan
nanoparticles (0.25g, 0. 5g, and 1g/kg), on a period of 90 days might be
adequate to improve fish growth, immune parameters, antioxidant status .
In addition, Nano diet improved growth performance and faster growth
rate through nutritional manipulation in Nile tilapia fish via improving
oxidative stress and improves immune function. Hence, the responses of
fish are likely to change depending on different doses. Therefore, further
investigations are encouraged in order to evaluate and understand the
effects of different levels of omega 3- chitosan nanoparticles on various
Nile tilapia fingerlings, as well as their reactions to different fish
pathogens. Omega 3 is a very important element for counteracting stress
responses in fish and livestock and showed significant efficiency at
nanoscale level. Animal and fishery researchers can initiate Nanochitosan
work because of its more bioavailability, bio efficacy, and low
toxicity. Industry can select this multipurpose feed additive against
diseases like cancer, gastro enteritis, etc. or as a common antidote and
immunomodulatory molecule against any single or composite stressors.
These findings suggest that omega 3- chitosan nanoparticles possess a
potential effect in Promoting growth in Nile tilapia fish via improving
oxidative stress and improves immune function. Future investigations
regarding omega 3- chitosan nanoparticles acts as an immunomodulatory
when used as a dietary supplement. omega 3- chitosan nanoparticles may
influence fish intestinal health by stimulating immunological parameters
and affecting the diversity of the microflora in the intestine.
Disclosure statement:
The authors declare no conflicts of interest, financial or otherwise.
253 Egypt. J. of Appl. Sci., 35 (12) 2020
REFERENCES:
[1] Oken, Lauren B. Guthrie ; Arienne Bloomingdale ; Deborah N.
Platek ; Sarah Price ; Jess Haines ; Matthew W. Gillman ;
Sjurdur F. Olsen. ; David C. Bellingerand and Robert O.
Wright (2013). A pilot randomized controlled trial to promote
healthful fish consumption during pregnancy: The Food for
Thought Study. doi: 10.1186/1475-2891-12-33 .
[2] Rather, M.A. ; R. Sharma ; M. Aklakur ; S. Ahmad ; N. Kumar
and M. Khan and et al .(2011). Nanotechnology: a novel tool
for aquaculture and fisheries development. A prospective minireview.
Fisheries and Aquaculture Journal., 16: 1–5.
[3] Amlashi, A.S. ; B. Falahatkar ; M. Sattari and M.H.T. Gilani
(2011). Effect of dietary vitamin E on growth, muscle
composition, hematological and immunological parameters of
sub-yearling beluga Huso huso L. Fish & Shellfish Immunology,
30(3); 807-814.
[4] Ibrahem, M.D. ; M. Fathi ; S. Mesalhy and A.M. Abd Elaty
(2010). Effect of dietary supplementation of inulin and vitamin
C on the growth, hematology, innate immunity, and resistance
of Nile tilapia (Oreochromis niloticus). Fish & Shellfish
Immunology, 29(2):1-246.
[5] Al-Thobaiti, A . ; K . Al-Ghanim ; Z. Ahmed ; E.M. Suliman and
S. Mahboob (2018). Impact of replacing fishmeal by a mixture
of different plant protein sources on the growth performance in
Nile Tilapia (Oreochromis niloticus L.) diets. Brazilian journal
of biology = Revista brasleira de biologia, 78(3): 525-534.
[6] Alemayehu, T.A. ; A. Geremew and A. Getahun (2018).The Role
of Functional Feed Additives in Tilapia Nutrition, Fisheries and
Aquaculture Journal., 9(2):1g-1g.
[7] Sharma, G. ; A.R. Sharma ; J.S. Nam ; G.P.C. Doss ; S.S. Lee and
C. Chakraborty (2015). Nanoparticle based insulin delivery
system: the next generation efficient therapy for Type 1
diabetes. J .Nanobiotechnology., 13: 74.
[8] Shimojoh, M. ; K. Fukushima and K. Kurita (1998). Lowmolecular-
weight chitosans derived from β-chitin: preparation,
molecular characteristics and aggregation activity. Carbohydr
Polym., 35:223–231.
[9]Surette, R. (2008). Copycat crime in central Florida. Unpublished
manuscript, Department of Criminal Justice, University of
Central Florida, Orlando, FL.
Egypt. J. of Appl. Sci., 35 (12) 2020 254
[10] Chapkin , R.S. ; W. Kim ; J.R. Lupton and D.N. McMurray
(2009). Dietary docosahexaenoic and eicosapentaenoic acid:
emerging mediators of inflammation. Prostaglandins Leukot
Essent Fatty Acids., 81(2–3): 187–191.
[11] Bazinet, R.P. and S. Layé, (2014).Polyunsaturated fatty acids and
their metabolites in brain function and disease. Nat Rev
Neurosci., 15(12):771–785.
[12] Scorletti, E. and C.D. Byrne (2018). Omega-3 fatty acids and nonalcoholic
fatty liver disease: Evidence of efficacy and
mechanism of action. Mol. Asp. Med., 64: 135–146.
[13] Qinna, N.A. ; F.T. Akayleh ; M.M. Al Remawi ; B.S. Kamona ;
H. Taha and A.A. Badwan (2013). Evaluation of a functional
food preparation based on chitosan as a meal replacement diet. J
Funct Food., 5:1125–1134.
[14] NRC (National Research Council. (1993).Nutrient Requirements
of fish. National Academy Press, Washington, DC, 112pp.
[15] Hawk, P.B. ; B.L. Oser and H.W. Summerson (1965). Hawks
physiological chemistry 12th edn. J. and A. Churchill Ltd,
London.
[16] Merrifield Daniel, L. ; Glenn M. Harper ; Sanaa Mustafa ;
Oliana Carnevali ; Simona Picchietti and Simon J. Davies.
(2011). Effect of dietary alginic acid on juvenile tilapia
(Oreochromis niloticus) intestinal microbial balance, intestinal
histology and growth performance .Cell and Tissue Research
volume 344, pages135–146.methods”. Eur J Clin Chem Clin
Biochem.; 34:385-386.
[17] Yatzidis, H.L. (1987). A colorimetric method for detection of total
protein. J Clinical Chemistry Journal., 23: 908.
[18] Doumas, B.T. ; W.A. Watson and H.G. Biggs (1971) . Albumin
standards and the measurement of serum albumin with
bromcresol green. Clinica Chimica Acta.,31(1): 87-96.
[19] Breuer, J .(6663). Report on the symposium “drug effects in
clinical chemistry methods”. Eur J Clin Chem Clin Biochem.;
34:385-386.
[20] Sherwin, J.E. ; L.A. Kaplan and A.J. Pesce (1984) Liver
function. eds.Clinical chemistry, theory, analysis, and
correlation. St louis: Mosby ; 420- 438.
[21] Naito, H.K. ; A. Kaplan and et al. (6651). Clin Chem the C.V.
Mosby Co. St Louis. Toronto. Princeton; 1194-11206 and 437.
255 Egypt. J. of Appl. Sci., 35 (12) 2020
[22] Burtis, C.A. and E.R. Ashwood (1999). Tietz Textbook of Clinical
Chemistry. 3rd Edition, W. B. Saunders Co., Philadelphia, 29-
150.
[23] Livak, K.J. and T.D. Schmittgen (2001). Analysis of relative gene
expression data using real-time quantitative PCR and the 2−
ΔΔCT method. Methods., 25: 402-408.
[24] Lee, P.T. ; C.M. Wen ; F.H. Nan ; H.Y. Yeh and M.C. Lee
(2020). Immunostimulatory effects of Sarcodia suiae water
extracts on Nile tilapia (Oreochromis niloticus) and its
resistance against Streptococcus agalactiae, Fish & Shellfish
Immunology., 103: 159-168.
[25] Kayansamruaj, P. ; H.T. Dong ; N. Pirarat ; D. Nilubol and
C. Rodkhum (2017). Efficacy of α-enolase-based DNA vaccine
against pathogenic Streptococcus iniae in Nile tilapia
(Oreochromis niloticus), Aquaculture., 468: 102-106.
[23] Rather , M.A. ; R. Sharma ; M. Aklakur ; S. Ahmad ; N. Kumar
; M. Khan and et al .(2011). Nanotechnology: a novel tool for
aquaculture and fisheries development. A prospective minireview.
Fisheries and Aquaculture Journal., 16: 1–5.
[24] Dawood, M.A.O. and S. Koshio (2016).Recent advances in the
role of probiotics and prebiotics in carp aquaculture: a review,
Aquaculture., 454 243e251.
[25] Ringø, E. A.; S.H. Dimitroglou and Hoseinifar S.J. Davies.
(2014). Prebiotics in Finfish: an Update, Aquaculture Nutrition,
John Wiley & Sons, Ltd, pp. 360e400.
[26] Nazzaro, F. ; P. Orlando ; F. Fratianni and R. Coppola (2012).
Microencapsulation in food science and biotechnology. Current
Opinion., 23: 182– 186.
[03] Schep, L.J. ; I.G. Tucker ; G. Young ; R. Ledger and A.G. Butt
(1999). Controlled release opportunities for oral peptide delivery
in aquaculture. Journal of Controlled Release., 59: 1– 14.
[36] Alishahi, A.; A. Mirvaghefia ; M.R. Tehranib ; H. Farahmanda ; S.
Koshioc ; F.A. Dorkoosh and et al . (2011). Chitosan
nanoparticle to carry vitamin C through the gastrointestinal tract
and induce the non-specific immunity system of rainbow trout
(Oncorhynchus mykiss ). Carbohydrate Polymers., 86: 142– 146.
[32] Scaife, J.R. ; J. Moyo ; H. Galbraith ; W. Michie and V.
Campbell (1994). Effect of different dietary supplemental fats
and oils on the tissue fatty acid composition and growth of
female broilers. British Poultry Science., 35: 107-118.
Egypt. J. of Appl. Sci., 35 (12) 2020 256
[30] Justi, K.C. ; C. Hayashi ; J.V. Visentainer ; N.E. Souza
and M. Matsushita (2003). The influence of feed supply time
on the fatty acid profile of Nile tilapia (Oreochromis niloticus)
fed on a diet enriched with n‐ 3 fatty acids. Food.
Chem., 80: 489– 493.
[31] Visentainer, J.V.; N.E. Souza ; M. Makoto ; C. Hayashi
and M.R.B. Franco (2005). Influence of diets enriched with
flaxseed oil on the alpha-linolenic, eicosapentaenoic and
docosahexaenoic fatty acid in Nile tilapia (Oreochromis
niloticus). Food. Chem., 90: 557– 560.
[32] Ahmad, S.A. ; M. Yousaf ; M.A. Sabri and Z. Kamran (2362).
Response of laying hens to omega-3 fatty acids for performance
and egg quality. Avian Biol. Res., 5: 1–10.
[33] Abu-Elala, N.M. ; S.H. Mohamed ; M.M. Zaki and A.E. Eissa
(2015). Assessment of the immune-modulatory and
antimicrobial effects of dietary chitosan on Nile tilapia
(Oreochrmis niloticus) with special emphasis to its bioremediating
impacts. Fish Shellfish Immunol., 46 (2): 678–685.
[34] Sun, B.Z. ; H.Z. Quan and F. Zhu (2016). Dietary chitosan
nanoparticles protect crayfish Procambarus clarkii against white
spot syndrome virus (WSSV) infection. Fish Shellfish
Immunol., 54: 241–246.
[35] Wang, L. ; X. Z. Zhang ; L. Wu ; Q. Liu ; D. F. Zhang and J.J.
Yin (2018).Expression of selenoprotein genes in muscle is
crucial for the growth of rainbow trout (Oncorhynchus mykiss)
fed diets supplemented with selenium yeast. Aquaculture, 492:
82–90.
[36] Cecchini, S. ; F. Fazio ; A.R. Caputo ; C. Saoca ; G. Fortino and
G. Piccione (2016) .Effect of two different farming systems on
the redox balance in gilthead sea bream Sparus aurata Linnaeus,
1758, Cah. Biol. Mar., 67 (1):65–71.
[13] Francesco Fazio ; Simona Marafioti ; Agata Torre ; Marilena
Sanfilippo ; Michele Panzera and Caterina Faggio (2013).
Effect of water quality on hematological and biochemical
parameters of Gobius Niger caught in Faro lake (Sicily), Iran. J.
Fish. Sci., 12 (1):219–231.
[16] Acar, U. ; V. Parrino ; O.S. Kesbicc ; G. Lo Paro ; C. Saoca ; F.
Abbate ; S. Yılmaz and F. Fazio (2365). Effects of different
levels of pomegranate seed oil on some blood parameters and
disease resistance against Yersinia ruckeri in rainbow trout,
Front. Physiol., 9: 596.
257 Egypt. J. of Appl. Sci., 35 (12) 2020
[42] Yilmaz, S. and S. Ergun (2365). Trans-cinnamic acid application
for rainbow trout (Oncorhynchus mykiss): I. Effects on
haematological, serum biochemical, nonspecific immune and
head kidney gene expression responses, Fish Shellfish
Immunol., 78: 140–157.
[40] Lemaitre, R.N. ; I.B. King ; D. Mozaffarian ; L.H. Kuller ; R.P.
Tracy and D.S. Siscovick (2003). n-3 polyunsaturated fatty
acids, fatal ischemic heart disease, and nonfatal myocardial
infarction in older adults: the Cardiovascular Health Study. Am
J Clin Nutr., 77: 319– 325.
[41] Hansen, S.N. and Harris , WS. (2007). New evidence for the
cardiovascular bene-fits of long chain omega-3 fatty acids. Curr
Atheroscler Rep., 9: 434 –440.
[42] Anil, E. (2007). The impact of EPA and DHA on blood lipids and
lipoprotein metabolism: influence of apoE genotype. Proc Nutr
Soc., 66: 60–68.
[43] Burk , R.F. ; K.E. Hill and A.K. Motley (2003). Selenoprotein
metabolism and function: evidence for more than one function
for selenoprotein P, J. Nutr. 133 (5 Suppl 1) 1517S-20S.
[44] Kumar, N. ; A.K. Garg and V. Mudgal (2008). Effect of different
levels of selenium supplementation on growth rate, nutrient
utilization, blood metabolic profile, and immune response in
lambs. Biol Trace Elem Res., 126: S44-56
[45] Chifiriuc , M.C. ; C. Kamerzan and V. Lazar (2017). Essential
oils and nanoparticles. In: Ficai A, Grumezescu AM (eds)
Nanostructures for Antimicrobial Therapy, pp. 279–291.
Elsevier, Amsterdam.
[46] Pavela , R. ; F. Maggi ; S.L. Ngahang Kamte ; R. Rakotosaona;
P. Rasoanaivo ; M. Nicoletti and et al. (2017). Chemical
composition of Cinnamosma madagascariensis (Cannelaceae)
essential oil and its larvicidal potential against the filariasis
vector Culex quinquefasciatus Say. South African Journal of
Botany., 108: 359– 363.
[23] Konieczka, P. ; M. Czauderna and S. Smulikowska (2017).The
enrichment of chicken meat with omega-3 fatty acids by dietary
fish oil or its mixture with rapeseed or flaxseed Effect of feeding
duration dietary fish oil, flaxseed, and rapeseed and n-3 enriched
broiler meat. Anim. Feed Sci. Technol., 223: 42–52.
Egypt. J. of Appl. Sci., 35 (12) 2020 258
[26] Florence, A. T. (2005). Nanoparticle uptake by the oral route:
Fulfilling its potential? Drug Discovery Today: Technologies, 2:
75–81.
[52] Pirarat, N. ; P. Pinpimai ; M. Endo ; T. Katagiri ; A.
Ponpornpisit ; N. Chansue and M. Maita (2011). Modulation
of intestinal morphology and immunity in the Nile tilapia
(Oreochromis niloticus) by Lactobacillus rhamnosus. Research
in Veterinary Science, 91: 92–97.
[50] Binoy Rajan ; Jorge M. O. Fernandes ; Christopher M. A.
Caipang ; Viswanath Kiron ; Jan H. W. M. Rombout
and Monica F Brinchmann (2011). Proteome reference map of
the skin mucus of Atlantic cod (Gadus morhua) revealing
immune competent molecules. Fish Shellfish
Immunol.,31(2):224-231.
[51] Martinez, R. ; Y. Carpio ; A. Morales ; J. M. Lugo ; F. Herrera ;
C. Zald_ıvar and M. P. Estrad (2016). Oral administration of
the growth hormone secretagogue-6 (GHRP-6) enhances growth
and non-specific immune responses in tilapia (Oreochromis sp.).
Aquaculture, 452, 304–310.
[52] Wen, Z. S.; Y. L. Xu ; X. T. Zou and Z. R. Xu (2011). Chitosan
nanoparticles act as an adjuvant to promote both Th1 and Th2
immune responses induced by ovalbumin in mice. Marine
Drugs, 9: 1038– 1055.
تأثير استخدام جزيئات الشيتو ا زن النانو المحملة بالاوميجا علي النمو في
السمک البلطي النيلي
همت محمد عيسي ، صفاء خاطر ، دعاء اب ا رهيم محمد ، مدحت محمد فوزي
کمية الطب البيطري ، جامعة الزقازيق ، مصر
تم التخطيط لهذا العمل لد ا رسة التأثير المحتمل لجسيمات أوميجا شيتو ا زن النانوية في
إصبعيات البمطي النيمي. تم استخدام مائتين وأربعين من إصبعيات البمطي النيمي في أربع
- مجموعات. نظام غذائي خالي من جزيئات أوميجا 3 - الشيتو ا زن النانوية ، أوميجا 3
جزيئات الشيتو ا زن النانوية ) 0.20 جم / کجم( ، جزيئات أوميجا 3 - الشيتو ا زن النانوية ) 0.0
جم / کجم( جزيئات أوميجا 3 - الشيتو ا زن النانوية ) 1 جم / کجم( لمدة 12 أسبوعًا. أظهرت
بياناتنا أنه تم العثور عمى فروق ذات دلالة إحصائية في متغي ا رت النمو ، بما في ذلک وزن
الجسم النهائي )جم( ، وکسب الجسم )جم( ، وکسب الجسم )٪( ، ونسبة کفاءة البروتين ،
ومعدل النمو النوعي )٪( ونسبة التحويل الغذائي. بالإضافة إلى ذلک، أظهرت بياناتنا المقدمة
259 Egypt. J. of Appl. Sci., 35 (12) 2020
، )HDLc( والبروتين الدهني عالي الکثافة ، )TAG( أن الکوليسترول الکمي، وثلاثي الجمسريد
alanine والألبومين و )TP( والبروتين الکمي )LDLc( تأثر البروتين الدهني منخفض الکثافة
معنويا بإضافة aspartate aminotransferase (AST) و aminotransferase (ALT)
p ( جزيئات أوميجا 3 - الشيتو ا زن النانوية في النظام الغذائي وأظهرت فروقا معنوية عالية
عمى الجموبيولين )p> 0.05 >(. ومع ذلک، لم تظهر فروق ذات دلالة إحصائية ) 0.05
،)IL1( في إنترلوکين 1 )P < ولکن کانت هناک فروق ذات دلالة إحصائية ) 0.05 )GLO(
في التعبير الجزيئي، کانت .)TNF-α( وعامل نخر ورم الأسماک ،)IL6( وانترلوکين 6
هي أهم معاممة تمت معالجتها عمى g / kg و 1 omega-chitosan NPs 0.5
ولکن النظام الغذائي الضابط في التعبير الجزيئي عن interleukin-1 beta (IL1- beta)
کان الأکثر علاجًا. )TLR2( مستقبلات شبيهة بالحصيمة 2
Egypt. J. of Appl. Sci., 35 (12) 2020 260