THE ROLE OF CAMELS IN DESSIMINATION OF PESTE DES PETITS RUMINANTS VIRUS AMONG SHEEP AND GOATS IN SAUDI ARABIA

Assut Vet. Med. J. Vol. 52 No. 110 July 2006

Dept. of Animal Medicine, Fac. Vet. Med. Assiut University

THE ROLE OF CAMELS IN DESSIMINATION OF PESTE DES PETITS RUMINANTS VIRUS AMONG SHEEP AND GOATS IN SAUDI ARABIA

(With 2 Tables and One Figure)

By U. ABD EL-HAKIM (Received at 22/3/2006)

دور الجمال في نشر فيروس مرض طاعون المجترات الصغيرة

في الأغنام والماعز بالعربية السعودية

أسامة عبد الحکيم لدراسة مرض طاعون المجترات الصغيرة في الجمال ومعرفة الدور الذي تلعبه الجمال في نشر الفيروس المسبب للمرض تم استخدام ۵۰ جمل ، 50 من الماعز و 50 من الأغنام على احتکاک مباشر بهذه الجمال. ولقد تم إجراء هذه الدراسة البحثية على حيوانات إحدى المزارع الحيوانية بالمملکة العربية السعودية خلال العام ۲۰۰۵/ ۲۰۰۹م. هذه الحيوانات تم فحصها من الناحية الإکلينيکية والفيروسية (العزل الفيروسی) وبإستخدام التکنولوجيا الحيوية اختبار التفاعل التبلمري المتسلسل). تم اجراء العزل الفيروسي واختبار التفاعل التبلمری المتسلسل مرتين يفصل بينهما شهر کما تم فحص

الحيوانات إکلينيکيا 3 مرات أسبوعيا. کل الحيوانات المستخدمة کانت سليمة من الناحية الإکلينيکية کما أظهر الفحص الإکلينيکي الأول الذي تم اجراءه عند بداية العمل. في الفحص الفيروسي الأول تم عزل فيروس طاعون المجترات الصغيرة والتعرف

عليه في 6 جمال بينما لم يتم عزل الفيروس في أي من الماعز

أو الأغنام. بعد اجراء اختبار التفاعل التبلمري المتسلسل الأول تم التعرف على الحامض النووي لفيروس

طاعون المجترات الصغيرة في ۱۰ جمال وکانت کل الماعز والأغنام المختبرة سلبية لهذا الاختبار. في الفحص الفيروسي الثاني تم عزل فيروس طاعون المجترات الصغيرة والتعرف

عليه في 11 جمل و ۳۲ من الماعز ولم يتم عزل الفيروس من أي من الأغنام التي تم فحصها. أظهر اختبار التفاعل التبلمري المتسلسل الثاني وجود الحامض النووي لفيروس

طاعون المجترات الصغيرة في ۱۷جمل و ۳۰ من الماعز بينما کانت کل الأغنام التي تم فحصها سلبية لهذا الاختبار. الفحص الإکلينيکي أوضح ظهور أعراض

اکلينيکية على ۲۱ من الماعز بعد اسبوعين من احتکاکها بالجمال التي ثبت اصابتها بفيروس طاعون المجترات الصغيرة. تمثلت هذه الأعراض فيحمى، التهابات في الفم، إفرازات عينية وأنفية، کحة، اسهال والتهاب رئوى بينما عانی 4 جمال من حمی، افرازات أنفية وکحة فقط. في نفس الوقت کانت باقي الحيوانات التي تم التأکد من اصابتها بفيروس طاعون المجترات الصغيرة بعد اجراء العزل الفيروسي واختبار التفاعل التبلمري المتسلسل (۱۳ جمل و14 من الماعز) سليمة من الناحية الإکلينيکية. نتائج هذا العمل أثبتت أن الجمال

132

Assut Vet. Med. J. Vol. 52 No. 110 July 2006

طاعون المجترات الصغيرة کما أنها تلعب دور هام جدا في نقل

قابلة للإصابة بمرض

خاصة أن معظم الجمال المصابة کانت سليمة ظاهريا وهذا هو

الفيروس المسبب للمرض أخطر صور المرض من الناحية الوبائية إلا أن هذا الدور لم يثبت في الأغنام المستخدمة في هذا العمل. کما أوضحت نتائج هذا العمل أن التفاعل التبلمري المتسلسل أسرع وأشد حساسية

طاعون المجترات الصغيرة في الجمال والماعز

مرض

من العزل الفيروسي في تشخيص

کما نوصي

المرض وفي أي دراسة وبائية للمرض

لهذا نوصي باستخدامه في تشخيص

طاعون

خلوها من مرض

الجمال الواردة من السودان للتأکد من

باستعماله في فحص

منه في مصر. هذه أول

المجترات الصغيرة حتى يمکن السيطرة على المرض والتخلص

طاعون المجترات الصغيرة في الجمال في الدول العربية والدور الذي

دراسة تتناول مرض

کما أننا نسجل هنا أول استعمال لاختبار

تلعبه الجمال في نشر الفيروس المسبب للمرض التفاعل التبلمري المتسلسل لتشخيص مرض طاعون المجترات الصغيرة في الجمال بالإضافة

لأول مرة في

طاعون المجترات الصغيرة النوع-۲ والنوع-

على فيروس

إلى التعرف الجمال.

SUMMARY

To study peste des petits ruminants (PPR) in camels and investigate role played by camels in transmission of PPR virus,50 camel, 50 goat and 50 sheep in contact with camels were used in the study. The animals were belonged to a private animal farm in the Kingdom of Saudi Arabia. These animals were examined clinically, virologically (virus isolation, VI), and by using molecular biology-based technique (Reverse transcription- polymerase chain reaction, RT-PCR). All used animals were clinically healthy as shown by clinical examination performed at the beginning of this work. Clinical examination was done three times a week while VI and RT-PCR were performed twice one month apart. Clinical examination showed that 4 camels were suffered from fever, nasal discharge and cough while 21 goats were suffered from fever, stomatitis, nasal and ocular discharges, diarrhea and pneumonia after two weeks from contact with infected camels. In the first virus isolation, PPR virus has been isolated from 6 camels while no PPR virus could be detected in examined goats and sheep. After performing first RT-PCR, PPR viral nucleic acid was identified in 10 camels but all examined goats and sheep were negative for this technique. PPR virus was isolated from 11 camels and 32 goats while all examined sheep were negative in the second virus isolation. The second RT-PCR showed presence of PPR viral nucleic acid in 17 camel and 35 goat while no PPR viral nucleic acid could be detected in all examined sheep. Results of this work proved that camel is susceptible to PPR and infected camel can transmit PPR virus to other camels as well as camels plays a very important role

133

Assut Vet. Med. J. Vol. 52 No. 110 July 2006

in dessimination of PPR virus to contact goats. Dangerous of this role increased by the fact that most infected camels were apparently healthy. This role not proved in sheep examined in this study. Also, our results showed that RT-PCR is faster and more sensitive than VI in diagnosis of PPR So, we recommend using of this technique in routine diagnosis of PPR and in any epidemiological studies concerning PPR as well as using this sensitive assay in examination of camels imported from Sudan to can control and eradicate this disease from Egypt.

Key words: Peste des petits ruminants (PPR), PPR virus, Camel, Sheep, Goat,

RT-PCR, Virus isolation

INTRODUCTION

Peste des petits ruminants (PPR) is an acute and highly contagious disease of small ruminants with high rates of morbidity and sometimes mortality (Raj et al., 2003; Choi et al., 2005a). Economically, it was the most important disease of small ruminants in Africa, Middle east and southwest Asia (Shaila et al., 1996; Berhe et al., 2003). The disease included in the list A of the international zoosanitary code and it is also a part of the FAO Empress programme (Subash et al., 2000; Diallo, 2003). Species susceptible to PPR virus are goats and sheep but it can infect deer and camels (Al-Naeem et al., 2000; Haroun et al., 2002; Abraham et al., 2005).

PPR was first described in the Ivory Coast of Africa in 1942 (Couacy-Hymann et al., 2005). After that, the geographic distribution of PPR is expanding and now includes Northern Africa, Asia and Turkey (Ozkul et al., 2002; Taylor et al., 2002; Lundervold et al., 2004; Cam et al., 2005). The disease was reported for the first time in Egypt in 1990 (Ismail and House, 1990; Ismail et al., 1990).

PPR is spreading from areas of endemicity in Africa and Asia to neighboring countries and has devastated the livestock industry. Countries free of the disease, especially countries or regions neighboring areas of endemicity, require extensive surveillance to prevent the introduction of the disease to naive animal population (Choi et al., 2005b).

PPR is caused by an enveloped RNA virus known as PPR virus which belongs to the Morbilivirus genus in the family Paramyxoviridae (Yilma et al., 2003). Other members of the genus Morbilivirus include rinderpest virus (RPV), measles virus (

MV), canine distemper virus (CDV), phocine distemper virus (PDV) and dolphin morbilivirus (DMV)

134

Assut Vet. Med. J. Vol. 52 No. 110 July 2006

(Choi et al., 2005a). PPR virus is genetically classified into four distinct lineages (I, II, III and IV) on the basis of partial sequence analysis of the fusion (F) protein (Choi et al., 2005a). Many strains of PPR virus are exist in Africa (Couacy-Hymann et al., 2005)

Rapid detection of infected animals is very important for PPR controls. Severe cases in which animals show clinical signs in the field can easily be detected through clinical surveillance and the detection of antigen in clinical samples, while the diagnosis of PPR infection in subclinically infected animals can be achieved by serological surveillance. However, the tests prescribed for the detection of PPR antibodies are laborious and expensive (Brindha et al., 2001; Couacy Hymann et al., 2002: Choi et al., 2005b).

Full length genome sequences for PPRV is published and the complete nucleotide sequence of the large polymerase (L) protein was determined. The gene is 6643 nucleotides in length and encoded a polypeptide of 2183 amino acids (Mahapatra et al., 2003;Baily et al., 2005; Muthuchelvan et al., 2005a; Muthuchelvan et al., 2005b).

RT-PCR system has been developed that detects and differentiates PPR virus from other closely related morbillivirus of ruminants. The capability of RT-PCR to deal with a large number of samples at a time and its short turnout time may be better serve the needs of surveillance and control programs. (Couacy-Hymann et al., 2002; Forsyth et al., 2003)

Information regarding PPR in camels are scarce and role of camels in dessimination of PPR virus and transmission of the disease to goats and sheep are not investigated before, therefore, the aim of the present work was to investigate PPR virus in camels and the role of these animals to dessiminate the virus among sheep and goats. Also, our goal was continued to compare between conventional VI and recent RT PCR in diagnostic techniques.

MATERIALS and METHODS

Animals: 50 camel (recently imported from Sudan), 50 goats and 50 sheep in contact with camels were used in the study. All used animals were with age ranged from 6 months to two years. Animals of the planned work were belonged to a private farm in Saudi Arabia Blood: 5/ml unclotted blood (using EDTA) was collected two times one month apart from each examined animal. These samples were used for extraction of RNA of the virus.

135

Assut Vet. Med. J. Vol. 52 No. 110 July 2006

Nasal swab: One nasal swab collected two times one month apart from each examined animal for isolation of the virus. Ocular swab: One ocular swab collected two times one month apart from each examined animal for isolation of the virus. 1- Clinical examination

Clinical examination of all investigated animals was performed three times weekly. Body temperature, respiratory and heart rates as well as pulse were recorded. Any abnormal clinical signs were reported. 2- Virus isolation (VI)

PPR virus was isolated from nasal and ocular swabs using Vero cell grown in Minimum essential medium (MEM) with 1% bovine fetal serum (GIBCO, Grand Island ,NY) which maintained for 21 days at 37 °C. The cytopathic effect of the virus (formation of multinucleated giant cell) was evaluated daily. The virus was identified and differentiated from other viruses causing syncytia (bovine respiratory syncytial virus and parainfluenza-3 virus) by immunofluorescence assay using fluorescent PPR virus antibodies (FA) conjugate (GIBCO, Grand Island, NY). Isolation and confirmation of presence of PPR virus were performed according to Nanda et al., (1996) with the modification of Choi et al., (2005a). The isolation of PPR virus as well as the various techniques were carried out in central laboratory of Ministry of Agriculture at Jeddah, Saudi Arabia. 3- Reverse transcription polymerase chain reaction (RT-PCR) (a) Synthetic oligonucleotide primers:

The primers for PPR virus (Pharmacia Biotech) were selected by comparison of published sequences of PPR virus (Mahapatra et al., 2003; Muthuchelvan et al., 2005a). Four primers were used in the present study. The details of these primers are listed in Table (1).

Table 1: Sequences and location of the oligonucleotide primers used for

PCR amplification of PPR virus.

Primer

Sequence 5-3'

Position

N-F1 GAGCTCATGGCGACTCTCCTCAAAAG N-R525 AACCATGGTCAGCTGAGGAGATCCTTGT N-R262 CGCCGGCGGAGTCCGGCTTCTACAATAT N-F405 CGCCGGCGCTTCGGACCCATTTGGGATC

PPR-L1=PPR Lineage-I

PPR-L2=PPR Lineage II PPR-L4=PPR Lineage-IV

(b) RNA extraction:

Expected

virus PPR-L1 PPR-L2 PPR-L3 PPR-L4 PPR-L3=PPR

1-262 1-525

1-447 405-521

Lineage III

136

Assut Vet. Med. J. Vol. 52 No. 110 July 2006

(b) RNA extraction:

Total RNA extraction was done as follow. Briefly, purified leucocyets were mixed with 5ml of guanidinum solution (4 M

guanidinium isothiocyanate, 25mM sodium citrate pH 7.0, 0.5%w/v sarcosyl, and 0.1 M 2-mercaptoethanol). Next, 0.5 ml of 2 M sodium acetate pH 4.0, 5 ml of phenol and 12 ml of chloroform/isoamyl alcohol (24:1) were sequentially added. The mixture was shaken for 10 seconds, cooled on ice for 15 min, and centrifuged at 10 000 g for 20 min at 4 °C. The aqueous phase was removed, precipitated with an equal volume of isopropanol, and placed at -20 °C overnight. The precipitated RNA was pelleted by centrifugation at 10 000 g for 30 min at 4°C. The RNA pellet was dried and then resuspended in 25 ul of diethylpyrocarbonate (DEPC) treated water. (C) Primer directed amplification:

This step was done using reagent supplied in a kit (Perkin Elmer Cetus Corp., Norwalk, CT) and a programmable DNA thermal cycler (Coy Laboratory products Inc., Ann Arbor, MI). First strand Complementary DNA (CDNA) synthesis was done using reverse transcriptase and random primers. The first strand reaction contained 1X RT buffer(250 mM Tris-Hcl, pH8.3, 375 mM KCl and 15 mM MgCl2), 10 mM dithiotheritol, 1 mM of each deoxynucleotide (dATP, dGTP, dTTP, CTP), 20units of RNasin, 300 ng of random hexanucleotide, 200 units of moloney murine leukemia virus reverse transcriptase (MMLV RT), and 8.5 ul of extracted PPRV RNA in a reaction volume of 20 u. The reaction mixture was incubated at 37 °C for 1 h, heat inactivated at 75 °C for 10 mins, and 80 ul of the following reaction mixture was added: 1X PCR buffer contains (500 mM KCl, 100 mMTris-HCl, pH 8.3, 1.25 uM of each upstream and downstream primers, 2.5 units of Ampli Taq polymerase, and 2 mM of MgCl2). The reaction mixture was initially denaturated at 94 °C for 4 min followed by 30 cycles of reaction parameters: template denaturationm at 94°C for 1 min, primer annealing at 55 °C for 1.5 min and extension at 72°C for 3 min.An additional incubation was done at 72°C for 7 min to complete the extension of templates. (d)Identification of PCR products:

Following amplification, 10 ul of PCR product was examined by 1% agarose gel electrophoresis in Tris acetate EDTA (TAE) buffer using a 1 Kb ladder as molecular weight standard. The gels were stained with ethidium bromide (0.5 ul / ml). The specificity of PCR were determined by observing the expected size of PCR product in the gel.

137

Assut Vet. Med. J. Vol. 52 No. 110 July 2006

RT-PCR was performed according to Forsyth and Barrett (1995) with modification of Saravanan et al., (2004). Various instruments and chemical reagents required for PCR - test were kindly supplied and done at a highly equipped laboratory in Ministry of Agriculture, Jeddah, Saudi Arabia.

RESULTS

1- Clinical examination

(a) Camels: All camels were clinically healthy at the beginning of the study. After one week 4 camels were suffered from fever, nasal discharge and cough while rest of examined camels were clinically healthy even those proved to be infected with PPR virus.

(b) Goats: All goats were clinically healthy at the beginning of the study. After two weeks from contact with infected camels 21 goats showed the following clinical signs: fever, stomatitis, nasal and ocular discharges, bloody diarrhea and pneumonia.

(c) Sheep: All examined sheep were healthy along the entire time of this study. 2- VI (a) First examination: PPR virus was isolated from 6 camels while no

PPR virus could be isolated from examined goats and sheep. (b) Second examination: PPR virus was isolated from 11 camel and 32

goat while all examined sheep were negative for virus isolation. 3- RT-PCR (a) First examination: PPR viral nucleic acid was detected in 10 camels,

the positive samples were belong to PPR virus lineage I (8 samples) and PPR virus lineage II (2 samples). No PPR viral nucleic acid

detected in examined goats and sheep. (b) Second examination: PPR viral nucleic acid was detected in 17

camel, the positive samples were belong to PPR virus lineage I (12 sample), PPR virus lineage II (3 samples) and PPR virus lineage IV (2 samples). PPR viral nucleic acid was detected in 35 goat, all of them were belong PPR virus lineage I. No nucleic acid detected in examined sheep.

Results of VI and RT-PCR are summarized in Table (2), and results of RT-PCR are shown in Figure (1).

138

Assut Vet. Med. J. Vol. 52 No. 110 July 2006

Table 2: Results of laboratory investigation of examined animals.

VIRUS ISOLSTION (VI) 16 exam. 2nd exam.

CAMELS

6

11

RT-PCR 15 exam. 2nd exam. L.I L.II L.IV L. I L. II LIV 8 8 2 2.

- 12 3 2 - - - 35 - . - - - - . .

GOATS

32

SHEEP

-

-

L.I = PPR virus lineage I

L.II = PPR virus lineage II L.IV = PPR virus lineage IV

FIG.1

1 2 3 4 5 6 7 8 91011121314151617

Fig. 1: Agarose gel electrophoresis of PCR product in examined camels,

goats and sheep. Lane 1 (DNA ladder), Lane2 (PPRV-Lineagel in camels), Lane6 (PPRV-LineageIV in camels), Lane (PPRV Lineagell in camels) Lanes 3, 4, 5 (negative results in camels), Lanes 11, 14 (PPRV-Lineagel in goats), Lanes 8, 10, 12 (negative results in goats), Lanes 9, 13, 15, 16, 17 (negative results in sheep)

139

Assut Vet. Med. J. Vol. 52 No. 110 July 2006

DISCUSSION

PPR is the most important disease of small ruminant in Africa and Middle East and recently it has become a much more prominent disease (Subash et al., 2000; Berhe et al., 2003). Goats and sheep are the species susceptible to PPR virus but the disease has been recorded in gazelles, deer, Arabian oryx and camels (El Zein et al., 2004; Abraham et al., 2005; Frolish et al., 2005). In the present work we detected PPR virus in goats and camels. The disease has been reported in Egypt and most parts of Africa (Ismail et al., 1990; Abraham and Berhan, 2001). No virus could be detected in examined sheep. Roeder et al., (1994) reported no affection among sheep during the first confirmed outbreak of PPR in Ethiopia and reported that goats are highly susceptible to PPR than sheep. The same observation has been recorded by Shaila et al., (1996) who added that the most susceptible animals to infection with PPR virus are goats.

Clinical signs reported in infected animals in this work were more severe in goats than camels. The same result has been recorded by Haroun et al., 2002, who concluded that goats are more susceptible to PPR virus than camels and usually suffered from acute form of the disease. However, most infected camels (13) and some infected goats (14) in our work were appeared healthy. Subclinical infection with PPR has been reported (Haroun et al., 2002; Abraham et al., 2005; Choi et al., 2005b; Diop et al., 2005) and only the most virulent strain show clinical disease (Subash et al., 2000).

In this study we used nasal swabs for isolation of PPR virus. Diop et al., (2005) in a survey carried out during PPR outbreak reported that between 85% and 100% of nasal secretions obtained from clinically diseased goats reacted positively to VI. We can add that PPR virus could be isolated from clinically diseased and apparently healthy goats and camels. At the same time, some clinically infected goats reacted negatively with VI in the present investigation. Animals with no detectable virus were able to seroconvert (Diop et al., 2005).However, we isolated PPR virus from ocular swabs also. Ismail and House, (1990) isolated PPR virus for the first time in Egypt from the ocular secretions and Nanda et al., (1996) and sumption et al., (1998) concluded that PPR virus excreted in lachrymal secretions of infected animals. No difference reported in this study between isolation of PPR virus from nasal and ocular swab. Many authors isolated PPR virus from ocular and nasal secretions and reported no difference (Diop et al., 2005).

140

Assut Vet. Med. J. Vol. 52 No. 110 July 2006

In this work, we used whole blood for extraction of nucleic acid of PPR virus, Forsyth and Barrett (1995) and Saravanan et al., (2004) used whole blood as a source of PPR nucleic acid. In our study we used RT-PCR for detection of nucleic acid of PPR virus. A highly sensitive technique (PCR) for the detection of PPR virus was developed (Mahapatra et al., 2003; Saravanan et al., 2004; Muthuchelvan et al., 2005b)

RT-PCR used in this study detected PPR nucleic acid in some clinical samples which were negative by conventional VI. The sar result was reported by Brindha et al., (2001) and Saravanan et al. (2004) who added that RT-PCR technique was more sensitive than VI in detecting PPR virus in early as well as late phase of the disease.

In this work, all samples gave positive results with VI were positive with RT-PCR beside some samples gave positive results with RT-PCR only, therefore RT-PCR proved to be more sensitive than VI. In comparison with conventional techniques used in diagnosis of PPR, RT-PCR was more sensitive (Couacy-Hymann et al., 2002; Forsyth et al., 2003). The samples that gave positive results with RT-PCR were belong to PPR virus lineage I, lineage II and lineage IV in infected camels and belong to lineage I only in goats. Presence of more than one lineage of PPR virus has been recorded (Haroun et al., 2002; Abraham et al., 2005; Choi et al., 2005a; Couacy-Hymann et al., 2005)

Results of this study proved that PPR virus could be transmitted from infected camels to goats. In a work of Haroun et al., (2002) and Abraham et al., (2005), they detected seroprevalences in camels and goats and they concluded that this antibody seroprevalences confirmed natural transmission of PPR virus under field conditions. From our recent results reported in this work, we can add that detection of PPR virus and PPR viral nucleic acids in both camels and contact goats is a very strong evidence of transmission of PPR virus from infected camels to goats which were free from PPR virus and PPR viral nucleic acid at the beginning of this study and before contact with the camels.

From results of this work we can conclude that camels could be infected with PPR virus but they usually show no clinical signs of the disease, therefore, they play a very important role in dessimination of PPR virus to susceptible goats in contact with them but this role did not observe in sheep examined in this study. PPR virus could be isolated from ocular and nasal swabs of clinically diseased and apparently healthy animals. RT-PCR is more sensitive than VI and could be used when VI failed to detect PPR virus, so, we recommend using of this

is.

141

Assut Vet. Med. J. Vol. 52 No. 110 July 2006

sensitive technique for diagnosis of PPR and for routine examination of imported camel in order to control and eradicate this dangerous disease from Egypt. This is the first study concerning PPR in camels in Arabic countries and role played by camels in dessimination of PPR virus and we recorded here the first using of RT-PCR in diagnosis of PPR in camels, in addition to the first recognition of PPR virus lineage II and lineage IV in camels.

REFERENCES

Abraham, G. and Berhan, A. (2001): The use of antigen-capture enzyme

linked immunosorbent assay (ELISA) for the diagnosis of rinderpest and peste des petits ruminants. Trop. Anim. Health.

Prod., 33 (5): 423-430. Abraham, G.; Sintayehu, A.; Libeau, G.; Albina, E.; Roger, F.;

Laekemariam, Y.; Abyneh, D. and Awoke, K. (2005): Antibody seroprevalences against peste des petits ruminants (PPR) virus in camels, cattle, goats and sheep in Ethiopia. Prev. Vet. Med.,

70 (1-2): 51-57. Al-Naeem, A.; Abu Elzein, E. and Al-Afaleq, A. (2000): Epizootiological

aspects of peste des petits ruminants and rinderpest in sheep

and goats in Saudi Arabia. Rev. Sci. Tech., 19 (3): 855-858. Baily, D.; Banyard, A., Dash, P.; Ozkul, A. and Barrett, T. (2005): Full

genome sequence of Peste des petits ruminants virus, a member of Morbillivirus genus. Virus Res., 110 (1-2): 119

124. Berhe, G., Minet, C.; LeGoff, C.; Barrett, T.; Ngangnou, A.; Grillet, C.;

Libeau, G.; Flemming, M.; Black, D. and Diallo, A. (2003): Development of a dual recombinant vaccine to protect small ruminants against peste des petits ruminants virus and

capripox virus infections. J. Virol., 77 (2): 1571-1577. Brindha, K.; Raj, G.; Ganesan, P.; Thiagarajan, V.; Nainar, A. and

Nachimuthu, K. (2001): Comparison of virus isolation and polymerase chain reaction for diagnosis of Peste des petits

ruminants. Arch. Virol., 45 (3):169-172. Cam, Y.; Geneay, A.; Beyaz, L.; Atalay, O.; Atasever, A.; Ozkul, A. and

Kibar, M. (2005): Peste des petits ruminants in a sheep and goat flock in Kayseri province, Turkey. Vet. Rec., 157 (17): 523-524.

142

Assut Vet. Med. J. Vol. 52 No. 110 July 2006

Choi, K.; Nah, J.; Ko, Y.; Yoon, S. and In JO, N. (2005a): antigenic and

immunogenic investigation of B-cell epitopes in the nucleocapsid protein of peste des petits ruminants. Clin.

Diagn. Lab. Immunol., 12 (1): 114-121. Choi, K.; Nah, J.; Ko, Y.; Kang, S. and Jo, N. (2005): Rapid

competitive enzyme linked immunosorbent assay for detection of antibodies to peste des petits ruminants virus. Clin. Diagn.

Lab. Immunol., 12 (4): 542-547. Couacy-Hymann, E.; Roger, F.; Hurard, C.; Guillou, J.; Libeau, G. and

Diallo, A. (2002): Rapid and sensitive detection of peste des petits ruminants virus by a polymerase chain reaction assay. J.

Virol. Methods, 100 (1-2): 17-25. Couacy-Hymann, E.; Bodjo, C.; Danho, T.; Libeau, G. and Diallo, A.

(2005): Evaluation of the virulence of some strains of peste des petits ruminants virus (PPRV) in experimentally infected

West African dwarf goats. Vet. J., 47: 516-523. Diallo, A. (2003): Control of peste des petits ruminants: classical and

new generation vaccines. Dev.Biol.,(114): 113-119. Diop, M.; Sarr, J. and Libeau, G. (2005): Evaluation of novel diagnostic

tools for peste des petits ruminants virus in naturally infected

goat herds. Epidemiol. Infect., 133 (4): 711-717. Elzein, E., Housawi, F.; Bashareek, Y.; Gameel, A.; Al-Afalek, A. and

Anderson, E. (2004): Severe PPR infection in gazelles kept under semi-free range conditions. J. Vet. Med. B Infect. Dis.

Vet. Public Health, 51 (2): 68-71. Forsyth, M. and Barrett, T. (1995): Evaluation of polymerase chain

reaction for the detection and characterization of rinderpest and peste des petits ruminants viruses for epidemiological

studies. Virus Res., 39 (2-3): 151-163. Forsyth, M.; Parida, S., Alexandersen, S., Belsham, G. and Barrett, T.

(2003): Rinderpest virus lineage differentiation using RT-PCR

and SNAP-ELISA. J. Virol. Methods, 107 (1): 29-36. Frolich, K.; Hamblin, C.; Jung, S.; Ostrowski, S.; Mwanzia, J.; Streich,

W.; Anderson, J.; Armstrong, R. and Anajariyah, S. (2005): Serologic survillance for selected viral agents in captive and free-ranging populations of Arabian oryx (Oryx leucoryx) from Saudi Arabia and United Arab Emirates. J. Wild Dis.,41 (1): 67-79.

143

Assut Vet. Med. J. Vol. 52 No. 110 July 2006

Haroun, M.; Majer, I.; Mukhtar, M. and Ali, B. (2002): Detection of

antibodies against peste des petits ruminants. Vet. Res.

Commun., 26 (7): 537-541. Ismail, I. and House, J. (1990): Evidence of identification of peste des

petits ruminants from goats in Egypt. Arch. Exp.

Veterinarmed., 44 (3): 471-474. Ismail, I.; Mohamed, F.; Aly, N.; Allam, N.; Hassan, H. and Saber, M.

(1990): Pathogenicity of peste des petits ruminants virus isolated from Egyptian goats in Egypt. Arch. Exp.

Veterinarmed., 44 (5): 789-792. Lundervold, M.; Miner-Gulland, E.O.; Callaghan, C.; Hamblin, C.;

Cortevn, A. and Macmillan, A. (2004): A serological survey of ruminant livestock in Kazakhsten during post Soviet transition in farming and disease control. Acta Vet. Scasnd., 45 (3-4):

211-224. Mahapatra, M.; Parida, S.; Egziabher, B.; Diallo, A. and Barrett, T.

(2003): Sequence analysis of the phosphoprotein gene of pesty des petits ruminants (PPR) virus: editing of the gene transcript.

Virus Res., 96 (1-2): 85-98. Muthuchelvan, D.; Sanyal, A.; Sarkar, J.; Sreenivasa, B. and

Bandyopadhyay (2005a): Comparative nucleotide sequence analysis of the phosphoprotein gene of petse des petits ruminants vaccine virus of Indian origin. Res. Vet. Sci., 68:

194-201. Muthuchelvan, D.: Sanyal. A.: Singh. R: Hemadri. D.: Sen. A.

Sreenivasa, B.; Singh, K. and Bandyopadhyay, S. (2005b): Comparative sequence analysis of the large polymerase protein (L) gene of peste-des-petits ruminants (PPR) vaccine

virus of Indian origin. Arch. Virol., 150 (12): 2467-2481. Nanda, Y.; Chatterjee, A.; Purohit, A.; Diallo, A.; Innui, K., Sharma, R.;

Libeau, G.; Thevasagayam, J.; Bruning, A.; Kitching, R.; Anderson, J.; Barrett, T. and Taylor, W. (1996): The isolation of peste des petits ruminants virus from northern India. Vet.

Microbiol., 51 (3-4): 20-7-216. Ozkul, A.; Akca, Y.; Aslkan, F.; Barrett, T.; Karaoglu, T.; Dagalp, S.;

Anderson, J.; Yesilbag, K; Kookcaliskan, C; Gencay, A. and Burgu, I. (2002): Prevalence, distribution and host range of peste des petits ruminants. Emerg. Infect. Dis., 8 (7): 708-712.

144

Assut Vet. Med. J. Vol. 52 No. 110 July 2006 Raj, G.; Kumar, A.; Shalia, M.; Nachimuthu, K. and Palaniswami, K.

(2003): Molecular epidemiology of peste des petits ruminants

viruses from southern India. Vet Rec., 152 (9): 264-266. Roeder, P.; Abraham, G.; Kenfe, G. and Barrett, T. (1994): Peste des

petits ruminants in Ethiopian goats. Trop. Anim. Health Prod.,

26 (2): 69-73. Saravanan, P.; Singh, R.; Balamurugan, V.; Dhar, P.; Sreenivasa, B.;

Muthuchelvan, D.; Sen, A.; Aleyas, A.; Singh, K. and Bandyopadlhyay, S. (2004): Development of a N gene-based PCR-ELISA for detection of peste des petits ruminants virus

in clinical samples. Arch. Virol., 48 (4): 249-255. Shaila, M.; Shamaki, M.; Forsyth, D.; Diallo, L.; Goatley, R.; Kitching,

P. and Barrett, T. (1996): Geographic distribution and epidemiology of peste des petits ruminants viruses. Virus res.

43: 149-153. Subash, C.; Michel, D.; Baron, D. and Barrett, T. (2000): Recovery and

characterization of a chimeric rinderpest virus with the glycoproteins of PPR virus: homologous F and H proteins are

required for virus viability. J. Virol., 9039-9047. Sumption, K.; Radom, G.; Libeau, G. and Wilsmore, A. (1998)

Detection of peste des petits ruminants virus antigen in conjunctival smears by indirect fluorescence. Vet. Rec., 142

(16): 421 - 424. Taylor, W.; Diallo, A.; Gopalakrishna, S.; Sreeramalu, P.; Wilsmore,

A.; Nanda, Y., Libeau, G., Rajasekhar, M. and Mukhopadhyay (2002): Peste des petits ruminants has been widely present in southern India since, if not before, the late 1980s. Prev. Vet.

Med., 52 (3-4): 305-312. Yilma, T.; Aziz, F, Ahmad, S.; Jones, L.; Ngotho, R., Wamwayi, H. ;

Beyene, B.; yesus, M.; Egzziabher, B.; Diop, M.; Sarr, J. and Veradi, P. (2003): Inexpensive vaccines and rapid diagnostic kits tailor-made for the global eradication of rinderpest and technology transfer to Africa and Asia. Dev. Biol. (Basel) 114: 99-111.

tl.

 

Article View: 258

PDF Download: 138